\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104339492:

Variant ID: vg0104339492 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 4339492
Reference Allele: TAAlternative Allele: TAAA,T,AA,TAA,TAAAA
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCACGCGTACGTTTTTTAAACTGCTAAAAACAGTATGTTTTTTTGCAAAAATTTTATATACAAAATTGCTTAAAAAATCATATTAATCTATTTTTT[TA/TAAA,T,AA,TAA,TAAAA]
AAAAAAATAGTAAATGGTTTATTAATCATAAGAAAATGTGTCACTCCATTTTACGTGCGTAGGAGGTGAGTTTCCAATCTCACCTCCCGAAACACAACCT

Reverse complement sequence

AGGTTGTGTTTCGGGAGGTGAGATTGGAAACTCACCTCCTACGCACGTAAAATGGAGTGACACATTTTCTTATGATTAATAAACCATTTACTATTTTTTT[TA/TTTA,A,TT,TTA,TTTTA]
AAAAAATAGATTAATATGATTTTTTAAGCAATTTTGTATATAAAATTTTTGCAAAAAAACATACTGTTTTTAGCAGTTTAAAAAACGTACGCGTGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 28.00% 3.51% 0.00% TAA: 2.48%; TAAA: 0.80%; T: 0.13%; TAAAA: 0.04%
All Indica  2759 46.90% 45.90% 3.23% 0.00% TAA: 2.46%; TAAA: 1.27%; T: 0.18%; TAAAA: 0.07%
All Japonica  1512 91.20% 1.70% 4.63% 0.00% TAA: 2.38%; TAAA: 0.13%
Aus  269 97.40% 1.10% 0.74% 0.00% T: 0.37%; TAA: 0.37%
Indica I  595 72.40% 21.50% 5.71% 0.00% TAA: 0.34%
Indica II  465 11.20% 84.70% 2.15% 0.00% TAA: 1.72%; TAAA: 0.22%
Indica III  913 49.20% 40.90% 1.64% 0.00% TAA: 5.15%; TAAA: 2.41%; T: 0.55%; TAAAA: 0.22%
Indica Intermediate  786 45.90% 47.30% 3.82% 0.00% TAAA: 1.53%; TAA: 1.40%
Temperate Japonica  767 90.90% 1.70% 5.48% 0.00% TAA: 1.69%; TAAA: 0.26%
Tropical Japonica  504 88.30% 2.00% 5.16% 0.00% TAA: 4.56%
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 87.50% 3.10% 0.00% 0.00% TAA: 8.33%; TAAA: 1.04%
Intermediate  90 61.10% 28.90% 5.56% 0.00% TAA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104339492 TA -> TAAA LOC_Os01g08700.1 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700.2 upstream_gene_variant ; 1009.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700.3 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700.4 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700.8 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700.5 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700.6 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08710.1 downstream_gene_variant ; 1355.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAA LOC_Os01g08700-LOC_Os01g08710 intergenic_region ; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.1 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.2 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.3 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.4 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.8 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.5 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700.6 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08710.1 downstream_gene_variant ; 1357.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> AA LOC_Os01g08700-LOC_Os01g08710 intergenic_region ; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.1 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.2 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.3 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.4 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.8 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.5 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700.6 upstream_gene_variant ; 1007.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08710.1 downstream_gene_variant ; 1356.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> T LOC_Os01g08700-LOC_Os01g08710 intergenic_region ; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.1 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.2 upstream_gene_variant ; 1009.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.3 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.4 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.8 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.5 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700.6 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08710.1 downstream_gene_variant ; 1355.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAA LOC_Os01g08700-LOC_Os01g08710 intergenic_region ; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.1 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.2 upstream_gene_variant ; 1009.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.3 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.4 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.8 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.5 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700.6 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08710.1 downstream_gene_variant ; 1355.0bp to feature; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0104339492 TA -> TAAAA LOC_Os01g08700-LOC_Os01g08710 intergenic_region ; MODIFIER silent_mutation Average:68.392; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104339492 NA 1.73E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0104339492 NA 1.98E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 4.47E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 6.24E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.33E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 5.21E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 4.70E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 7.01E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.82E-16 mr1319_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 8.36E-09 mr1319_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 3.21E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 3.27E-17 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 7.86E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 4.59E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.17E-13 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 8.40E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 2.61E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 8.63E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.27E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.22E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 3.43E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.02E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104339492 NA 1.34E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251