Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104322740:

Variant ID: vg0104322740 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4322740
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CCAATTATATTACGCGTGTTAGTTGCAATTACCAGAGGTTTACATGATTATTGTTAGTCATACGAATATGCGATACAGAAAATTGCAAACACAGTAACAA[T/A]
CAATATTATCATTGATTATTTTAGATGAATATGGCTATTGTTAGTAGCAATTAGCAGAGGTTTACATGACAAAGGTGGTGCTTTTCGCTAAATATTTAAG

Reverse complement sequence

CTTAAATATTTAGCGAAAAGCACCACCTTTGTCATGTAAACCTCTGCTAATTGCTACTAACAATAGCCATATTCATCTAAAATAATCAATGATAATATTG[A/T]
TTGTTACTGTGTTTGCAATTTTCTGTATCGCATATTCGTATGACTAACAATAATCATGTAAACCTCTGGTAATTGCAACTAACACGCGTAATATAATTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	7.50%	1.61%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.07%	0.00%	NA
All Japonica	1512	73.60%	21.60%	4.76%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	54.00%	37.50%	8.47%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	82.60%	14.90%	2.49%	0.00%	NA
VI/Aromatic	96	79.20%	19.80%	1.04%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104322740	T -> A	LOC_Os01g08680.1	3_prime_UTR_variant ; 252.0bp to feature; MODIFIER	silent_mutation	Average:56.86; most accessible tissue: Callus, score: 86.883	N	N	N	N
vg0104322740	T -> A	LOC_Os01g08680.2	3_prime_UTR_variant ; 252.0bp to feature; MODIFIER	silent_mutation	Average:56.86; most accessible tissue: Callus, score: 86.883	N	N	N	N
vg0104322740	T -> A	LOC_Os01g08670.1	upstream_gene_variant ; 3960.0bp to feature; MODIFIER	silent_mutation	Average:56.86; most accessible tissue: Callus, score: 86.883	N	N	N	N
vg0104322740	T -> A	LOC_Os01g08690.1	upstream_gene_variant ; 3838.0bp to feature; MODIFIER	silent_mutation	Average:56.86; most accessible tissue: Callus, score: 86.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104322740	NA	2.21E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	1.06E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	5.27E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	4.97E-06	3.83E-06	mr1467	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	2.86E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	3.20E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	1.95E-08	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	8.61E-06	mr1666_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740	NA	1.68E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251