\
| Variant ID: vg0104322740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4322740 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )
CCAATTATATTACGCGTGTTAGTTGCAATTACCAGAGGTTTACATGATTATTGTTAGTCATACGAATATGCGATACAGAAAATTGCAAACACAGTAACAA[T/A]
CAATATTATCATTGATTATTTTAGATGAATATGGCTATTGTTAGTAGCAATTAGCAGAGGTTTACATGACAAAGGTGGTGCTTTTCGCTAAATATTTAAG
CTTAAATATTTAGCGAAAAGCACCACCTTTGTCATGTAAACCTCTGCTAATTGCTACTAACAATAGCCATATTCATCTAAAATAATCAATGATAATATTG[A/T]
TTGTTACTGTGTTTGCAATTTTCTGTATCGCATATTCGTATGACTAACAATAATCATGTAAACCTCTGGTAATTGCAACTAACACGCGTAATATAATTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 7.50% | 1.61% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 73.60% | 21.60% | 4.76% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 54.00% | 37.50% | 8.47% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 14.90% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 19.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104322740 | T -> A | LOC_Os01g08680.1 | 3_prime_UTR_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:56.86; most accessible tissue: Callus, score: 86.883 | N | N | N | N |
| vg0104322740 | T -> A | LOC_Os01g08680.2 | 3_prime_UTR_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:56.86; most accessible tissue: Callus, score: 86.883 | N | N | N | N |
| vg0104322740 | T -> A | LOC_Os01g08670.1 | upstream_gene_variant ; 3960.0bp to feature; MODIFIER | silent_mutation | Average:56.86; most accessible tissue: Callus, score: 86.883 | N | N | N | N |
| vg0104322740 | T -> A | LOC_Os01g08690.1 | upstream_gene_variant ; 3838.0bp to feature; MODIFIER | silent_mutation | Average:56.86; most accessible tissue: Callus, score: 86.883 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104322740 | NA | 2.21E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 1.06E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 5.27E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | 4.97E-06 | 3.83E-06 | mr1467 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 2.86E-06 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 3.20E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 1.95E-08 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 8.61E-06 | mr1666_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104322740 | NA | 1.68E-06 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |