\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104322740:

Variant ID: vg0104322740 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4322740
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CCAATTATATTACGCGTGTTAGTTGCAATTACCAGAGGTTTACATGATTATTGTTAGTCATACGAATATGCGATACAGAAAATTGCAAACACAGTAACAA[T/A]
CAATATTATCATTGATTATTTTAGATGAATATGGCTATTGTTAGTAGCAATTAGCAGAGGTTTACATGACAAAGGTGGTGCTTTTCGCTAAATATTTAAG

Reverse complement sequence

CTTAAATATTTAGCGAAAAGCACCACCTTTGTCATGTAAACCTCTGCTAATTGCTACTAACAATAGCCATATTCATCTAAAATAATCAATGATAATATTG[A/T]
TTGTTACTGTGTTTGCAATTTTCTGTATCGCATATTCGTATGACTAACAATAATCATGTAAACCTCTGGTAATTGCAACTAACACGCGTAATATAATTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 7.50% 1.61% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 73.60% 21.60% 4.76% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 54.00% 37.50% 8.47% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 82.60% 14.90% 2.49% 0.00% NA
VI/Aromatic  96 79.20% 19.80% 1.04% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104322740 T -> A LOC_Os01g08680.1 3_prime_UTR_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:56.86; most accessible tissue: Callus, score: 86.883 N N N N
vg0104322740 T -> A LOC_Os01g08680.2 3_prime_UTR_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:56.86; most accessible tissue: Callus, score: 86.883 N N N N
vg0104322740 T -> A LOC_Os01g08670.1 upstream_gene_variant ; 3960.0bp to feature; MODIFIER silent_mutation Average:56.86; most accessible tissue: Callus, score: 86.883 N N N N
vg0104322740 T -> A LOC_Os01g08690.1 upstream_gene_variant ; 3838.0bp to feature; MODIFIER silent_mutation Average:56.86; most accessible tissue: Callus, score: 86.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104322740 NA 2.21E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 1.06E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 5.27E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 4.97E-06 3.83E-06 mr1467 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 2.86E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 3.20E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 1.95E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 8.61E-06 mr1666_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104322740 NA 1.68E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251