\
| Variant ID: vg0104049262 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4049262 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )
ATTGATTCAACTATGGCCGCTGCGATGCTCACACATGGCCAACACCTCTTCTTGACCTTTGGAGAAGAGAAGCGATTCAACTCAATTCAGGCCAAGTTTT[C/T]
CAAACTTTTTCTTCAAACTTCCAACTTTTCCATCACATCAAAACTTTACTACACACACAAACTTCCAATTTTTCCGTTACATCATTCCAATTTTAATCAA
TTGATTAAAATTGGAATGATGTAACGGAAAAATTGGAAGTTTGTGTGTGTAGTAAAGTTTTGATGTGATGGAAAAGTTGGAAGTTTGAAGAAAAAGTTTG[G/A]
AAAACTTGGCCTGAATTGAGTTGAATCGCTTCTCTTCTCCAAAGGTCAAGAAGAGGTGTTGGCCATGTGTGAGCATCGCAGCGGCCATAGTTGAATCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 4.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 8.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104049262 | C -> T | LOC_Os01g08270.1 | downstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:59.694; most accessible tissue: Callus, score: 89.265 | N | N | N | N |
| vg0104049262 | C -> T | LOC_Os01g08270.4 | downstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:59.694; most accessible tissue: Callus, score: 89.265 | N | N | N | N |
| vg0104049262 | C -> T | LOC_Os01g08260-LOC_Os01g08270 | intergenic_region ; MODIFIER | silent_mutation | Average:59.694; most accessible tissue: Callus, score: 89.265 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104049262 | 2.11E-06 | 2.76E-09 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 2.03E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 4.00E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 2.38E-06 | mr1327 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 2.11E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | 2.99E-06 | 2.21E-07 | mr1480 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | 4.76E-06 | 4.76E-06 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 1.31E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | 4.04E-06 | 3.37E-10 | mr1692 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | 5.30E-06 | 4.46E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 5.45E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 5.29E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 7.04E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 6.66E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104049262 | NA | 7.13E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |