Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104048901:

Variant ID: vg0104048901 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4048901
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTGTTTATTTTAAGAGCGATATCCCTCCATTCCATTCCACCGATCGAGGGCATACGTTGTCTTCGTCGGTGTGTGGTGCTACTGCTGCAGTAGGTTG[T/C]
CGTACATACTCCTCTGTCCAAAAAAAATTAAACTCTAGGAATGAATATGGACACACACTAACACACGTGTGTCTAGATTCATCATTTTTTTTTGACGGAC

Reverse complement sequence

GTCCGTCAAAAAAAAATGATGAATCTAGACACACGTGTGTTAGTGTGTGTCCATATTCATTCCTAGAGTTTAATTTTTTTTGGACAGAGGAGTATGTACG[A/G]
CAACCTACTGCAGCAGTAGCACCACACACCGACGAAGACAACGTATGCCCTCGATCGGTGGAATGGAATGGAGGGATATCGCTCTTAAAATAAACAAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.50%	20.00%	1.14%	53.32%	NA
All Indica	2759	2.30%	8.50%	1.59%	87.60%	NA
All Japonica	1512	73.10%	23.90%	0.33%	2.65%	NA
Aus	269	0.00%	91.40%	0.00%	8.55%	NA
Indica I	595	1.30%	14.80%	1.68%	82.18%	NA
Indica II	465	3.20%	1.70%	0.86%	94.19%	NA
Indica III	913	2.20%	5.00%	1.31%	91.46%	NA
Indica Intermediate	786	2.50%	11.80%	2.29%	83.33%	NA
Temperate Japonica	767	86.20%	10.40%	0.26%	3.13%	NA
Tropical Japonica	504	69.20%	28.40%	0.20%	2.18%	NA
Japonica Intermediate	241	39.80%	57.30%	0.83%	2.07%	NA
VI/Aromatic	96	17.70%	79.20%	0.00%	3.12%	NA
Intermediate	90	23.30%	30.00%	5.56%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104048901	T -> DEL	N	N	silent_mutation	Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0104048901	T -> C	LOC_Os01g08270.1	downstream_gene_variant ; 2955.0bp to feature; MODIFIER	silent_mutation	Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0104048901	T -> C	LOC_Os01g08270.4	downstream_gene_variant ; 2955.0bp to feature; MODIFIER	silent_mutation	Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0104048901	T -> C	LOC_Os01g08260-LOC_Os01g08270	intergenic_region ; MODIFIER	silent_mutation	Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104048901	NA	5.52E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	3.08E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	9.66E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	6.69E-14	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	4.05E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	3.01E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	8.60E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	1.20E-12	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	1.78E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	8.56E-08	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	8.90E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	4.85E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	1.14E-08	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	4.69E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	2.14E-12	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	7.72E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	5.57E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	5.81E-07	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	4.85E-06	mr1460_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	4.55E-06	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	2.00E-08	mr1597_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	7.15E-09	mr1729_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	1.65E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	8.92E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901	NA	2.87E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251