\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104048901:

Variant ID: vg0104048901 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4048901
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTGTTTATTTTAAGAGCGATATCCCTCCATTCCATTCCACCGATCGAGGGCATACGTTGTCTTCGTCGGTGTGTGGTGCTACTGCTGCAGTAGGTTG[T/C]
CGTACATACTCCTCTGTCCAAAAAAAATTAAACTCTAGGAATGAATATGGACACACACTAACACACGTGTGTCTAGATTCATCATTTTTTTTTGACGGAC

Reverse complement sequence

GTCCGTCAAAAAAAAATGATGAATCTAGACACACGTGTGTTAGTGTGTGTCCATATTCATTCCTAGAGTTTAATTTTTTTTGGACAGAGGAGTATGTACG[A/G]
CAACCTACTGCAGCAGTAGCACCACACACCGACGAAGACAACGTATGCCCTCGATCGGTGGAATGGAATGGAGGGATATCGCTCTTAAAATAAACAAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.50% 20.00% 1.14% 53.32% NA
All Indica  2759 2.30% 8.50% 1.59% 87.60% NA
All Japonica  1512 73.10% 23.90% 0.33% 2.65% NA
Aus  269 0.00% 91.40% 0.00% 8.55% NA
Indica I  595 1.30% 14.80% 1.68% 82.18% NA
Indica II  465 3.20% 1.70% 0.86% 94.19% NA
Indica III  913 2.20% 5.00% 1.31% 91.46% NA
Indica Intermediate  786 2.50% 11.80% 2.29% 83.33% NA
Temperate Japonica  767 86.20% 10.40% 0.26% 3.13% NA
Tropical Japonica  504 69.20% 28.40% 0.20% 2.18% NA
Japonica Intermediate  241 39.80% 57.30% 0.83% 2.07% NA
VI/Aromatic  96 17.70% 79.20% 0.00% 3.12% NA
Intermediate  90 23.30% 30.00% 5.56% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104048901 T -> DEL N N silent_mutation Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0104048901 T -> C LOC_Os01g08270.1 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0104048901 T -> C LOC_Os01g08270.4 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0104048901 T -> C LOC_Os01g08260-LOC_Os01g08270 intergenic_region ; MODIFIER silent_mutation Average:57.195; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104048901 NA 5.52E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 3.08E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 9.66E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 6.69E-14 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 4.05E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 3.01E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 8.60E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 1.20E-12 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 1.78E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 8.56E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 8.90E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 4.85E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 1.14E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 4.69E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 2.14E-12 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 7.72E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 5.57E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 5.81E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 4.85E-06 mr1460_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 4.55E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 2.00E-08 mr1597_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 7.15E-09 mr1729_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 1.65E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 8.92E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104048901 NA 2.87E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251