\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104020130:

Variant ID: vg0104020130 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4020130
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CTAATTACACAGATTGCGACTAATTTGCGAAGCGAATCTTTTAAGCCTAATTGCTCCATGATTTGATAATGTGGTGCTACAGTAACCATTTGCTAATGAC[G/T]
GATTAATTAGGCTTAATAAATTCGTCTCACAGTTTACTGATGGATTCTATAATTAGTTTTTTTATTAATGCCCAAACACTCCATGCGACACCCTATATAA

Reverse complement sequence

TTATATAGGGTGTCGCATGGAGTGTTTGGGCATTAATAAAAAAACTAATTATAGAATCCATCAGTAAACTGTGAGACGAATTTATTAAGCCTAATTAATC[C/A]
GTCATTAGCAAATGGTTACTGTAGCACCACATTATCAAATCATGGAGCAATTAGGCTTAAAAGATTCGCTTCGCAAATTAGTCGCAATCTGTGTAATTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 46.40% 0.04% 0.00% NA
All Indica  2759 87.90% 12.10% 0.04% 0.00% NA
All Japonica  1512 3.00% 97.00% 0.07% 0.00% NA
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 83.90% 16.00% 0.17% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 90.50% 9.50% 0.00% 0.00% NA
Indica Intermediate  786 82.60% 17.40% 0.00% 0.00% NA
Temperate Japonica  767 3.70% 96.20% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104020130 G -> T LOC_Os01g08240.1 downstream_gene_variant ; 3016.0bp to feature; MODIFIER silent_mutation Average:41.349; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0104020130 G -> T LOC_Os01g08250.1 downstream_gene_variant ; 4725.0bp to feature; MODIFIER silent_mutation Average:41.349; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0104020130 G -> T LOC_Os01g08220-LOC_Os01g08240 intergenic_region ; MODIFIER silent_mutation Average:41.349; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104020130 NA 1.03E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 5.23E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 2.36E-12 mr1151 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 2.17E-17 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 3.19E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.13E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 2.74E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.21E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 3.20E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 3.53E-09 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.37E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.06E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 3.73E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.76E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 9.66E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 6.98E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 8.31E-09 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.22E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 9.76E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 6.25E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 7.96E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.30E-14 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.02E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 6.08E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.06E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 2.12E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 9.43E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.92E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 4.96E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 5.04E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104020130 NA 1.46E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251