\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104005677:

Variant ID: vg0104005677 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4005677
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCATACACGTCGAATTTCATTCGATATTTTACTTTCAGTAGCAAGATCTTCATGCTAGTTCCCATATACAGTACTACATCCGTTTCAGGTTATAAGAC[G/A]
TCTTGACTTTAGTCAAAATCAAACTGCTTTAAGTTTGACTAATTTTATAGAAAAAGTAGTAATATTTTTAACTCAAGACAAATTTATTATGAAAATATAT

Reverse complement sequence

ATATATTTTCATAATAAATTTGTCTTGAGTTAAAAATATTACTACTTTTTCTATAAAATTAGTCAAACTTAAAGCAGTTTGATTTTGACTAAAGTCAAGA[C/T]
GTCTTATAACCTGAAACGGATGTAGTACTGTATATGGGAACTAGCATGAAGATCTTGCTACTGAAAGTAAAATATCGAATGAAATTCGACGTGTATGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.70% 0.17% 0.00% NA
All Indica  2759 93.50% 6.30% 0.18% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 32.30% 66.50% 1.12% 0.00% NA
Indica I  595 90.80% 9.10% 0.17% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 96.10% 3.90% 0.00% 0.00% NA
Indica Intermediate  786 90.20% 9.30% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104005677 G -> A LOC_Os01g08220.1 upstream_gene_variant ; 731.0bp to feature; MODIFIER silent_mutation Average:45.611; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0104005677 G -> A LOC_Os01g08220-LOC_Os01g08240 intergenic_region ; MODIFIER silent_mutation Average:45.611; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104005677 NA 2.28E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 1.10E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 3.12E-13 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 8.65E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 7.13E-06 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 8.87E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 7.45E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 2.33E-10 mr1343 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 2.09E-06 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 5.38E-06 5.38E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 7.33E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 5.18E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 9.37E-09 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 9.18E-07 1.31E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 2.68E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 9.39E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 5.73E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 1.41E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104005677 NA 4.65E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251