\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103998281:

Variant ID: vg0103998281 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3998281
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGTATTTTTCAAGACAAATCTATTCATATAATTTTTATATTTTCAAACTCAACAACTTTATTCATGATTTATATTCCAAGGTTTGACTTAAACATT[G/A]
TCCTAAACGGCTTTATTTATGAGTATGCTTTAGAGCACCCGCAATGGTAAAGTAAGGTGTTATCTATAAAACATGTACATCTCAGCAATAGACTAGATTA

Reverse complement sequence

TAATCTAGTCTATTGCTGAGATGTACATGTTTTATAGATAACACCTTACTTTACCATTGCGGGTGCTCTAAAGCATACTCATAAATAAAGCCGTTTAGGA[C/T]
AATGTTTAAGTCAAACCTTGGAATATAAATCATGAATAAAGTTGTTGAGTTTGAAAATATAAAAATTATATGAATAGATTTGTCTTGAAAAATACTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 38.00% 11.43% 12.44% NA
All Indica  2759 3.20% 60.30% 18.16% 18.34% NA
All Japonica  1512 96.60% 2.00% 0.66% 0.79% NA
Aus  269 53.50% 29.00% 1.12% 16.36% NA
Indica I  595 3.40% 52.60% 28.91% 15.13% NA
Indica II  465 2.60% 49.50% 25.16% 22.80% NA
Indica III  913 1.50% 71.20% 10.51% 16.76% NA
Indica Intermediate  786 5.50% 59.80% 14.76% 19.97% NA
Temperate Japonica  767 96.20% 2.60% 0.91% 0.26% NA
Tropical Japonica  504 96.60% 1.20% 0.60% 1.59% NA
Japonica Intermediate  241 97.50% 1.70% 0.00% 0.83% NA
VI/Aromatic  96 68.80% 2.10% 10.42% 18.75% NA
Intermediate  90 47.80% 25.60% 17.78% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103998281 G -> A LOC_Os01g08200.1 downstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:30.884; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0103998281 G -> A LOC_Os01g08200-LOC_Os01g08220 intergenic_region ; MODIFIER silent_mutation Average:30.884; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0103998281 G -> DEL N N silent_mutation Average:30.884; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103998281 NA 1.57E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 7.58E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 1.81E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 5.67E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 4.88E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.89E-09 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.01E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 1.63E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.11E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 2.02E-06 1.67E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 4.43E-07 4.43E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 8.87E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 3.92E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 8.28E-06 mr1330 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.11E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 2.26E-06 9.35E-09 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 1.48E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 5.69E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 8.19E-06 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 4.98E-06 4.98E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 6.83E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 6.11E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 2.93E-06 5.47E-06 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 6.01E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.43E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 6.16E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.02E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 1.73E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 5.94E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.21E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 9.40E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 2.07E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103998281 NA 3.53E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251