\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103935216:

Variant ID: vg0103935216 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3935216
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCCAAAGAGTACTAAGAGAGAAGATCATACTCCTAGGCCTGGTTTAGATTCAAAGTTTGAACCCAAATATGTCACATCGAACTTTTCTACACACACAA[A/G]
CTTTCAACTTTTTTTCGTCACATCGTTTCAATTTCAATGAAACTTCCGATTTTGACGTGTAACTAAACACACCTTAGTACTCTAAAAACGTGTGGATGAT

Reverse complement sequence

ATCATCCACACGTTTTTAGAGTACTAAGGTGTGTTTAGTTACACGTCAAAATCGGAAGTTTCATTGAAATTGAAACGATGTGACGAAAAAAAGTTGAAAG[T/C]
TTGTGTGTGTAGAAAAGTTCGATGTGACATATTTGGGTTCAAACTTTGAATCTAAACCAGGCCTAGGAGTATGATCTTCTCTCTTAGTACTCTTTGGACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 9.30% 0.00% 0.00% NA
All Indica  2759 86.00% 14.00% 0.00% 0.00% NA
All Japonica  1512 96.90% 3.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 81.70% 18.30% 0.00% 0.00% NA
Indica III  913 83.20% 16.80% 0.00% 0.00% NA
Indica Intermediate  786 85.40% 14.60% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103935216 A -> G LOC_Os01g08140.1 upstream_gene_variant ; 2533.0bp to feature; MODIFIER silent_mutation Average:49.629; most accessible tissue: Callus, score: 83.947 N N N N
vg0103935216 A -> G LOC_Os01g08130.1 downstream_gene_variant ; 1864.0bp to feature; MODIFIER silent_mutation Average:49.629; most accessible tissue: Callus, score: 83.947 N N N N
vg0103935216 A -> G LOC_Os01g08150.1 downstream_gene_variant ; 3915.0bp to feature; MODIFIER silent_mutation Average:49.629; most accessible tissue: Callus, score: 83.947 N N N N
vg0103935216 A -> G LOC_Os01g08130-LOC_Os01g08140 intergenic_region ; MODIFIER silent_mutation Average:49.629; most accessible tissue: Callus, score: 83.947 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103935216 NA 4.69E-11 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 1.39E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 4.38E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 2.98E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 2.93E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 5.77E-07 3.06E-12 mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 1.75E-09 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 7.18E-11 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 4.76E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 1.65E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 3.90E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 3.66E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103935216 NA 1.42E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251