\
| Variant ID: vg0103935216 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3935216 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 254. )
TGTCCAAAGAGTACTAAGAGAGAAGATCATACTCCTAGGCCTGGTTTAGATTCAAAGTTTGAACCCAAATATGTCACATCGAACTTTTCTACACACACAA[A/G]
CTTTCAACTTTTTTTCGTCACATCGTTTCAATTTCAATGAAACTTCCGATTTTGACGTGTAACTAAACACACCTTAGTACTCTAAAAACGTGTGGATGAT
ATCATCCACACGTTTTTAGAGTACTAAGGTGTGTTTAGTTACACGTCAAAATCGGAAGTTTCATTGAAATTGAAACGATGTGACGAAAAAAAGTTGAAAG[T/C]
TTGTGTGTGTAGAAAAGTTCGATGTGACATATTTGGGTTCAAACTTTGAATCTAAACCAGGCCTAGGAGTATGATCTTCTCTCTTAGTACTCTTTGGACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103935216 | A -> G | LOC_Os01g08140.1 | upstream_gene_variant ; 2533.0bp to feature; MODIFIER | silent_mutation | Average:49.629; most accessible tissue: Callus, score: 83.947 | N | N | N | N |
| vg0103935216 | A -> G | LOC_Os01g08130.1 | downstream_gene_variant ; 1864.0bp to feature; MODIFIER | silent_mutation | Average:49.629; most accessible tissue: Callus, score: 83.947 | N | N | N | N |
| vg0103935216 | A -> G | LOC_Os01g08150.1 | downstream_gene_variant ; 3915.0bp to feature; MODIFIER | silent_mutation | Average:49.629; most accessible tissue: Callus, score: 83.947 | N | N | N | N |
| vg0103935216 | A -> G | LOC_Os01g08130-LOC_Os01g08140 | intergenic_region ; MODIFIER | silent_mutation | Average:49.629; most accessible tissue: Callus, score: 83.947 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103935216 | NA | 4.69E-11 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 1.39E-11 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 4.38E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 2.98E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 2.93E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | 5.77E-07 | 3.06E-12 | mr1951 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 1.75E-09 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 7.18E-11 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 4.76E-08 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 1.65E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 3.90E-10 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 3.66E-08 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103935216 | NA | 1.42E-06 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |