\
| Variant ID: vg0103847902 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3847902 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 236. )
CGGGGCCTCTGTCTGTTGCATTATCAATATAAGAGGTCAAATTAGTTTGTTTCTGGGGAATAATGTGTGAGCTCCACAGTACATCACTTTTTTGACAAAG[T/C]
TTTACATAGGAGATAAAGTTTTAGCTTTGATATCCCTGGTGGCTGGGTAGTTACTTAATTCTCTTGCATAGCTTCTTTCCATGTCATACGCCATATTCAC
GTGAATATGGCGTATGACATGGAAAGAAGCTATGCAAGAGAATTAAGTAACTACCCAGCCACCAGGGATATCAAAGCTAAAACTTTATCTCCTATGTAAA[A/G]
CTTTGTCAAAAAAGTGATGTACTGTGGAGCTCACACATTATTCCCCAGAAACAAACTAATTTGACCTCTTATATTGATAATGCAACAGACAGAGGCCCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 16.80% | 0.02% | 0.04% | NA |
| All Indica | 2759 | 81.50% | 18.40% | 0.04% | 0.07% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.40% | 92.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 52.30% | 47.20% | 0.17% | 0.34% | NA |
| Indica II | 465 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103847902 | T -> DEL | N | N | silent_mutation | Average:55.311; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0103847902 | T -> C | LOC_Os01g07950.1 | downstream_gene_variant ; 2361.0bp to feature; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0103847902 | T -> C | LOC_Os01g07960.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0103847902 | T -> C | LOC_Os01g07960.3 | intron_variant ; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0103847902 | T -> C | LOC_Os01g07960.2 | intron_variant ; MODIFIER | silent_mutation | Average:55.311; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103847902 | NA | 6.19E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103847902 | NA | 1.29E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103847902 | NA | 4.41E-15 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103847902 | NA | 2.19E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103847902 | NA | 2.88E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103847902 | NA | 3.07E-27 | mr1874_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103847902 | NA | 1.14E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |