\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103747442:

Variant ID: vg0103747442 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3747442
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATAATTTGAATTAAAATATTATGAAAATGATTTGAGAATGATGATATTTAGCATGTGTATGTTTAGTTTTGAATGAAATAAATTGTAGATATAATTA[C/T]
TATATGCTTGTATGTTGAGCTTTATGTGCTTAATAGGTTGATGTGGCATGCTTGCATGTAGTTTTTACGAGTGGTAATAAATATTCTCTCCGTCTTAAAA

Reverse complement sequence

TTTTAAGACGGAGAGAATATTTATTACCACTCGTAAAAACTACATGCAAGCATGCCACATCAACCTATTAAGCACATAAAGCTCAACATACAAGCATATA[G/A]
TAATTATATCTACAATTTATTTCATTCAAAACTAAACATACACATGCTAAATATCATCATTCTCAAATCATTTTCATAATATTTTAATTCAAATTATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 1.90% 2.12% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 87.80% 5.80% 6.35% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 78.10% 11.10% 10.82% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 94.60% 0.80% 4.56% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103747442 C -> T LOC_Os01g07810.1 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:59.99; most accessible tissue: Minghui63 root, score: 82.185 N N N N
vg0103747442 C -> T LOC_Os01g07810.2 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:59.99; most accessible tissue: Minghui63 root, score: 82.185 N N N N
vg0103747442 C -> T LOC_Os01g07810.3 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:59.99; most accessible tissue: Minghui63 root, score: 82.185 N N N N
vg0103747442 C -> T LOC_Os01g07820.1 downstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:59.99; most accessible tissue: Minghui63 root, score: 82.185 N N N N
vg0103747442 C -> T LOC_Os01g07810-LOC_Os01g07820 intergenic_region ; MODIFIER silent_mutation Average:59.99; most accessible tissue: Minghui63 root, score: 82.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103747442 2.97E-07 1.76E-08 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103747442 NA 7.25E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103747442 NA 6.83E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251