\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103731353:

Variant ID: vg0103731353 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3731353
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.36, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AACTGTTAGTCATGTTCTTCACGTGTTACCGGCTTACAGCACACATCTCTTTTGTGGTTCCCGTATTCTTCTCAAGCAAACACTGAAAACACTACTCCAC[T/C]
ATATGTCAGTAGGTCGCACATTTACAACACATTAGTTAATTTCGTGGATGAGGTTTAGTAATTATTCTCTGGATGGATATATCTAAAAGCTATTTTTTCT

Reverse complement sequence

AGAAAAAATAGCTTTTAGATATATCCATCCAGAGAATAATTACTAAACCTCATCCACGAAATTAACTAATGTGTTGTAAATGTGCGACCTACTGACATAT[A/G]
GTGGAGTAGTGTTTTCAGTGTTTGCTTGAGAAGAATACGGGAACCACAAAAGAGATGTGTGCTGTAAGCCGGTAACACGTGAAGAACATGACTAACAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.20% 0.08% 0.00% NA
All Indica  2759 89.40% 10.50% 0.14% 0.00% NA
All Japonica  1512 54.80% 45.20% 0.00% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 79.70% 20.00% 0.22% 0.00% NA
Indica Intermediate  786 88.40% 11.60% 0.00% 0.00% NA
Temperate Japonica  767 89.40% 10.60% 0.00% 0.00% NA
Tropical Japonica  504 7.50% 92.50% 0.00% 0.00% NA
Japonica Intermediate  241 43.20% 56.80% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103731353 T -> C LOC_Os01g07760.1 upstream_gene_variant ; 2069.0bp to feature; MODIFIER silent_mutation Average:66.184; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0103731353 T -> C LOC_Os01g07770.1 upstream_gene_variant ; 797.0bp to feature; MODIFIER silent_mutation Average:66.184; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0103731353 T -> C LOC_Os01g07780.1 upstream_gene_variant ; 4476.0bp to feature; MODIFIER silent_mutation Average:66.184; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0103731353 T -> C LOC_Os01g07760.2 upstream_gene_variant ; 2750.0bp to feature; MODIFIER silent_mutation Average:66.184; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0103731353 T -> C LOC_Os01g07760-LOC_Os01g07770 intergenic_region ; MODIFIER silent_mutation Average:66.184; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103731353 NA 3.67E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 2.00E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 6.34E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 8.65E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 1.13E-17 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 5.22E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 4.20E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 9.54E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 3.33E-08 NA mr1719 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 5.46E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 8.86E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 5.98E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 4.41E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 4.50E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 4.95E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 2.45E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 3.56E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 7.76E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 6.62E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 1.82E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 1.13E-19 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 3.43E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 1.72E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103731353 NA 7.23E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251