Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103658465:

Variant ID: vg0103658465 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3658465
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGCCACTCCGTCCTCCTCCGCCTGCTTCCTCCACATCCGCGATCGCCGCCGCCACATCCGCGACCGCCGCCTCCTCGTCCGCGTCCAACCTCTGCCTC[C/T]
GCGACCGGCCTCGTCCGCGATCGCCTCCGCGACCGATCGCCGCCGCTCGTCCGTGCCTCGCCTCGCCTCCGCGACCCGCCTCCACCTCTCCTCCGCTCGC

Reverse complement sequence

GCGAGCGGAGGAGAGGTGGAGGCGGGTCGCGGAGGCGAGGCGAGGCACGGACGAGCGGCGGCGATCGGTCGCGGAGGCGATCGCGGACGAGGCCGGTCGC[G/A]
GAGGCAGAGGTTGGACGCGGACGAGGAGGCGGCGGTCGCGGATGTGGCGGCGGCGATCGCGGATGTGGAGGAAGCAGGCGGAGGAGGACGGAGTGGCACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	44.40%	0.25%	0.00%	NA
All Indica	2759	27.80%	71.90%	0.29%	0.00%	NA
All Japonica	1512	95.80%	4.10%	0.13%	0.00%	NA
Aus	269	93.70%	6.30%	0.00%	0.00%	NA
Indica I	595	54.80%	44.70%	0.50%	0.00%	NA
Indica II	465	6.20%	93.50%	0.22%	0.00%	NA
Indica III	913	26.30%	73.60%	0.11%	0.00%	NA
Indica Intermediate	786	21.80%	77.90%	0.38%	0.00%	NA
Temperate Japonica	767	93.70%	6.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.00%	0.40%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103658465	C -> T	LOC_Os01g07610.1	upstream_gene_variant ; 3223.0bp to feature; MODIFIER	silent_mutation	Average:71.179; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N
vg0103658465	C -> T	LOC_Os01g07600.1	downstream_gene_variant ; 1986.0bp to feature; MODIFIER	silent_mutation	Average:71.179; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N
vg0103658465	C -> T	LOC_Os01g07600-LOC_Os01g07610	intergenic_region ; MODIFIER	silent_mutation	Average:71.179; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0103658465	C	T	0.0	0.0	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103658465	2.20E-06	2.20E-06	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	2.03E-06	1.29E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	2.36E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	3.03E-08	3.03E-08	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	1.81E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	2.17E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	2.23E-06	1.03E-11	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	1.25E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	1.63E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	6.03E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	3.91E-07	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	7.18E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	6.28E-09	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103658465	NA	5.13E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251