Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103590789:

Variant ID: vg0103590789 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3590789
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACCACCACCACGACGCTGGCCCAAGGTCACACATGACAGTCGTGCGGGCGCGTGTGCTTTCACTGTACCCGGCGTCTGCGCCCATGGCTGGCTGGCC[G/A]
GACCCGGACGGGAGGGAGGGACCATCGATCGGAGCGAGAGCTGCAGCGAGGATTTATAAAACCGCACTATTATCGTGTTTATCATTAAAAAAATAATATT

Reverse complement sequence

AATATTATTTTTTTAATGATAAACACGATAATAGTGCGGTTTTATAAATCCTCGCTGCAGCTCTCGCTCCGATCGATGGTCCCTCCCTCCCGTCCGGGTC[C/T]
GGCCAGCCAGCCATGGGCGCAGACGCCGGGTACAGTGAAAGCACACGCGCCCGCACGACTGTCATGTGTGACCTTGGGCCAGCGTCGTGGTGGTGGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	43.00%	0.34%	0.06%	NA
All Indica	2759	30.10%	69.30%	0.51%	0.11%	NA
All Japonica	1512	95.20%	4.60%	0.13%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	57.30%	41.20%	1.18%	0.34%	NA
Indica II	465	9.20%	90.80%	0.00%	0.00%	NA
Indica III	913	27.60%	72.10%	0.33%	0.00%	NA
Indica Intermediate	786	24.70%	74.70%	0.51%	0.13%	NA
Temperate Japonica	767	92.70%	7.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.00%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103590789	G -> A	LOC_Os01g07510.1	downstream_gene_variant ; 2951.0bp to feature; MODIFIER	silent_mutation	Average:96.023; most accessible tissue: Callus, score: 99.427	N	N	N	N
vg0103590789	G -> A	LOC_Os01g07520.1	downstream_gene_variant ; 1022.0bp to feature; MODIFIER	silent_mutation	Average:96.023; most accessible tissue: Callus, score: 99.427	N	N	N	N
vg0103590789	G -> A	LOC_Os01g07510-LOC_Os01g07520	intergenic_region ; MODIFIER	silent_mutation	Average:96.023; most accessible tissue: Callus, score: 99.427	N	N	N	N
vg0103590789	G -> DEL	N	N	silent_mutation	Average:96.023; most accessible tissue: Callus, score: 99.427	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0103590789	G	A	0.04	0.03	0.03	0.02	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103590789	NA	1.02E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	7.44E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	4.29E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	1.69E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	7.27E-07	7.27E-07	mr1516	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	3.35E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	1.62E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	4.33E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	1.41E-06	1.41E-06	mr1967	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103590789	NA	4.07E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251