\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103576159:

Variant ID: vg0103576159 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3576159
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAGAAGATGACATGTGGGACCCACATGTCAGTGGGTCCCACAATTTTTTTTTGTGTGAATGATAAATGGGCCCACATATTTTTTTTATTTTAATGCAC[G/A]
TAAGCGCCACGTCAATGCCACGTGGAACAAAAACCAGGTCAACACTGCCACGTGTGCGCCACGTCAGCGAAACCACCATCCAAAACCACCAAGGAAGTTA

Reverse complement sequence

TAACTTCCTTGGTGGTTTTGGATGGTGGTTTCGCTGACGTGGCGCACACGTGGCAGTGTTGACCTGGTTTTTGTTCCACGTGGCATTGACGTGGCGCTTA[C/T]
GTGCATTAAAATAAAAAAAATATGTGGGCCCATTTATCATTCACACAAAAAAAAATTGTGGGACCCACTGACATGTGGGTCCCACATGTCATCTTCTCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.60% 0.02% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 36.80% 63.10% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 27.60% 72.40% 0.00% 0.00% NA
Tropical Japonica  504 56.70% 43.30% 0.00% 0.00% NA
Japonica Intermediate  241 24.50% 75.10% 0.41% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103576159 G -> A LOC_Os01g07490.1 upstream_gene_variant ; 1879.0bp to feature; MODIFIER silent_mutation Average:77.843; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0103576159 G -> A LOC_Os01g07500.1 downstream_gene_variant ; 1307.0bp to feature; MODIFIER silent_mutation Average:77.843; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0103576159 G -> A LOC_Os01g07490-LOC_Os01g07500 intergenic_region ; MODIFIER silent_mutation Average:77.843; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103576159 G A 0.02 0.02 0.03 0.02 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103576159 NA 5.92E-08 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103576159 NA 3.71E-06 mr1152 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103576159 NA 7.12E-07 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103576159 NA 9.68E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103576159 4.16E-06 NA mr1889 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103576159 NA 6.98E-07 mr1889 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103576159 NA 1.14E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251