Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0103541882:

Variant ID: vg0103541882 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3541882
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGGATTACAATTTGGAAATTGTAATTTGATTTGGTAACTGAGGTTAGAGTCTTAGTGGAACTAGGCGTTATACTCCTACTTTGAGTAGGAGGTTTTTT[A/T,C]
TTTTATAAATAGAGAGGGAGGGGTGGCCTCCCGCTATCGCTTTGAGAGCAATTGAGTTGATAGTTTAGTTAGGGTTTCGAGTTTAGTCGAGATTTTTGTA

Reverse complement sequence

TACAAAAATCTCGACTAAACTCGAAACCCTAACTAAACTATCAACTCAATTGCTCTCAAAGCGATAGCGGGAGGCCACCCCTCCCTCTCTATTTATAAAA[T/A,G]
AAAAAACCTCCTACTCAAAGTAGGAGTATAACGCCTAGTTCCACTAAGACTCTAACCTCAGTTACCAAATCAAATTACAATTTCCAAATTGTAATCCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.00% 32.00% 6.47% 16.48% C: 0.02%
All Indica  2759 22.30% 51.10% 7.90% 18.63% C: 0.04%
All Japonica  1512 89.30% 4.40% 1.65% 4.70% NA
Aus  269 23.00% 5.60% 15.61% 55.76% NA
Indica I  595 54.10% 38.80% 4.37% 2.69% NA
Indica II  465 13.50% 55.10% 8.60% 22.80% NA
Indica III  913 12.00% 50.90% 9.97% 26.94% C: 0.11%
Indica Intermediate  786 15.30% 58.40% 7.76% 18.58% NA
Temperate Japonica  767 91.90% 7.30% 0.39% 0.39% NA
Tropical Japonica  504 86.30% 1.40% 1.79% 10.52% NA
Japonica Intermediate  241 87.10% 1.20% 5.39% 6.22% NA
VI/Aromatic  96 63.50% 0.00% 11.46% 25.00% NA
Intermediate  90 45.60% 21.10% 11.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103541882 A -> T LOC_Os01g07470.1 downstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:67.918; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0103541882 A -> T LOC_Os01g07470-LOC_Os01g07480 intergenic_region ; MODIFIER silent_mutation Average:67.918; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0103541882 A -> DEL N N silent_mutation Average:67.918; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0103541882 A -> C LOC_Os01g07470.1 downstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:67.918; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N
vg0103541882 A -> C LOC_Os01g07470-LOC_Os01g07480 intergenic_region ; MODIFIER silent_mutation Average:67.918; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103541882 A C -0.02 -0.01 0.0 0.0 0.01 0.01
vg0103541882 A T 0.0 0.0 0.0 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103541882 NA 1.51E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 NA 2.16E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 NA 1.24E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 1.75E-06 NA mr1212_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 NA 2.71E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 NA 3.63E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 NA 9.57E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103541882 NA 7.43E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251