\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103525065:

Variant ID: vg0103525065 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3525065
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACAAATTAAACAAATTGTGATGTGTGTTGGAACTTTGGTCATAATTCGGCATATTTTAATCCAAAATAACAAGATAATAAACATGATATTTACAATG[A/G]
GATTTGATCCAGTGATAGTGGTGAATGTAATCAACATGAGCATGCTTAATGTAGAATAAGCATCAACAATCACATAATAACACAATATTGACATTGCGAT

Reverse complement sequence

ATCGCAATGTCAATATTGTGTTATTATGTGATTGTTGATGCTTATTCTACATTAAGCATGCTCATGTTGATTACATTCACCACTATCACTGGATCAAATC[T/C]
CATTGTAAATATCATGTTTATTATCTTGTTATTTTGGATTAAAATATGCCGAATTATGACCAAAGTTCCAACACACATCACAATTTGTTTAATTTGTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 37.20% 5.04% 8.80% NA
All Indica  2759 49.30% 37.10% 4.93% 8.66% NA
All Japonica  1512 55.50% 44.40% 0.00% 0.13% NA
Aus  269 8.90% 10.40% 30.11% 50.56% NA
Indica I  595 62.70% 36.30% 1.01% 0.00% NA
Indica II  465 60.20% 25.60% 9.89% 4.30% NA
Indica III  913 38.90% 38.90% 5.81% 16.43% NA
Indica Intermediate  786 44.90% 42.40% 3.94% 8.78% NA
Temperate Japonica  767 68.40% 31.60% 0.00% 0.00% NA
Tropical Japonica  504 30.20% 69.60% 0.00% 0.20% NA
Japonica Intermediate  241 67.20% 32.40% 0.00% 0.41% NA
VI/Aromatic  96 51.00% 6.20% 10.42% 32.29% NA
Intermediate  90 47.80% 31.10% 12.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103525065 A -> G LOC_Os01g07430.1 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:24.725; most accessible tissue: Callus, score: 53.24 N N N N
vg0103525065 A -> G LOC_Os01g07430-LOC_Os01g07450 intergenic_region ; MODIFIER silent_mutation Average:24.725; most accessible tissue: Callus, score: 53.24 N N N N
vg0103525065 A -> DEL N N silent_mutation Average:24.725; most accessible tissue: Callus, score: 53.24 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103525065 3.97E-06 3.97E-06 mr1015 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 3.10E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 5.89E-10 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 1.01E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 4.79E-06 4.79E-06 mr1122 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 7.94E-07 7.93E-07 mr1130 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 4.36E-07 mr1152 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 3.29E-08 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 1.53E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 2.51E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 3.93E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 1.27E-06 mr1889 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103525065 NA 9.90E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251