\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103512299:

Variant ID: vg0103512299 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3512299
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGAGGCTGTCGCCGCCGGCGCTCGTGCCCAGGAGTGAGTGCCCCTCCTCCTCCTCTTCGTGCTCCTCTCTGCTTCTCCTCCCCTCGCGCTCCTAGCAA[A/G]
TAGGAGTAGTACTCGAGCTTGCGCGATCTGTGTGGGAGAGGGGAGGTCGTGGCTTCTCTGATTCGGGCGGTTGGGGCGAGTCAAATGCGGTTGCTTGGTG

Reverse complement sequence

CACCAAGCAACCGCATTTGACTCGCCCCAACCGCCCGAATCAGAGAAGCCACGACCTCCCCTCTCCCACACAGATCGCGCAAGCTCGAGTACTACTCCTA[T/C]
TTGCTAGGAGCGCGAGGGGAGGAGAAGCAGAGAGGAGCACGAAGAGGAGGAGGAGGGGCACTCACTCCTGGGCACGAGCGCCGGCGGCGACAGCCTCGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 19.20% 0.02% 0.00% NA
All Indica  2759 99.20% 0.70% 0.04% 0.00% NA
All Japonica  1512 46.50% 53.50% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 33.10% 66.90% 0.00% 0.00% NA
Tropical Japonica  504 72.40% 27.60% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103512299 A -> G LOC_Os01g07400.1 downstream_gene_variant ; 1768.0bp to feature; MODIFIER silent_mutation Average:88.945; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N
vg0103512299 A -> G LOC_Os01g07420.1 downstream_gene_variant ; 4359.0bp to feature; MODIFIER silent_mutation Average:88.945; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N
vg0103512299 A -> G LOC_Os01g07400.2 downstream_gene_variant ; 1768.0bp to feature; MODIFIER silent_mutation Average:88.945; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N
vg0103512299 A -> G LOC_Os01g07410.1 intron_variant ; MODIFIER silent_mutation Average:88.945; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103512299 A G 0.02 0.01 0.0 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103512299 NA 9.88E-07 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 5.89E-06 NA mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 2.20E-10 mr1092 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 9.56E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 7.48E-06 7.48E-06 mr1122 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 1.12E-06 1.12E-06 mr1130 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 8.60E-08 mr1152 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 6.68E-09 mr1154 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 5.41E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 4.23E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 1.64E-06 mr1889 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 2.11E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 4.11E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103512299 NA 7.63E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251