\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103479251:

Variant ID: vg0103479251 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 3479251
Reference Allele: AAlternative Allele: C,ACTGGATATGACATATTC
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAGAGCGTGGCTGCCTGGGTATATTTTTCACATAGGCCCCTCCTATACTTTCCTACTCCCTCCATCCCACGAAAAACAAATTTAGTATTGGATATAGT[A/C,ACTGGATATGACATATTC]
TATTCTAATACTACGAAATCTAGGCAAATATATATCCAGATTCATAGCAATAGGATGTGTCACATCCAGTACTAGATTGGTTTTTTGTGAAACGGAGAGA

Reverse complement sequence

TCTCTCCGTTTCACAAAAAACCAATCTAGTACTGGATGTGACACATCCTATTGCTATGAATCTGGATATATATTTGCCTAGATTTCGTAGTATTAGAATA[T/G,GAATATGTCATATCCAGT]
ACTATATCCAATACTAAATTTGTTTTTCGTGGGATGGAGGGAGTAGGAAAGTATAGGAGGGGCCTATGTGAAAAATATACCCAGGCAGCCACGCTCTTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 22.60% 1.57% 1.50% ACTGGATATGACATATTC: 0.47%
All Indica  2759 82.10% 12.60% 2.07% 2.46% ACTGGATATGACATATTC: 0.80%
All Japonica  1512 70.60% 28.90% 0.40% 0.07% NA
Aus  269 17.10% 81.40% 1.49% 0.00% NA
Indica I  595 90.90% 1.30% 4.87% 2.86% NA
Indica II  465 89.70% 7.30% 1.08% 1.94% NA
Indica III  913 71.50% 22.50% 0.99% 2.96% ACTGGATATGACATATTC: 2.08%
Indica Intermediate  786 83.10% 12.80% 1.78% 1.91% ACTGGATATGACATATTC: 0.38%
Temperate Japonica  767 92.80% 6.50% 0.65% 0.00% NA
Tropical Japonica  504 37.90% 61.70% 0.20% 0.20% NA
Japonica Intermediate  241 68.50% 31.50% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 39.60% 1.04% 0.00% NA
Intermediate  90 64.40% 26.70% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103479251 A -> DEL N N silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07360.1 upstream_gene_variant ; 1917.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07364.1 upstream_gene_variant ; 271.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07360.3 upstream_gene_variant ; 1917.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07360.4 upstream_gene_variant ; 1615.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07360.2 upstream_gene_variant ; 1327.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07370.1 downstream_gene_variant ; 87.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07370.2 downstream_gene_variant ; 87.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> C LOC_Os01g07364-LOC_Os01g07370 intergenic_region ; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07360.1 upstream_gene_variant ; 1918.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07364.1 upstream_gene_variant ; 272.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07360.3 upstream_gene_variant ; 1918.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07360.4 upstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07360.2 upstream_gene_variant ; 1328.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07370.1 downstream_gene_variant ; 86.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07370.2 downstream_gene_variant ; 86.0bp to feature; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N
vg0103479251 A -> ACTGGATATGACATATTC LOC_Os01g07364-LOC_Os01g07370 intergenic_region ; MODIFIER silent_mutation Average:98.845; most accessible tissue: Zhenshan97 root, score: 99.646 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103479251 A ACTGG* -0.17 -0.28 -0.24 -0.14 -0.16 -0.18
vg0103479251 A C -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103479251 3.26E-06 3.26E-06 mr1355 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103479251 3.56E-07 3.55E-07 mr1355 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251