\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103472849:

Variant ID: vg0103472849 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3472849
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GGTAGTAGTGTAGTAAAAATCAAATCTAACCATTGATTGTAATGGGTAGTTTAGACTTTTATAACATTAACGGGAAAGGGCATTTTAGCCTATTTCGGTG[C/A]
TCCCGCGAGGTCAACACAGGCCAGGTTCGATCCGCCCAAGTCGCGTTCTGCGCCCTTCCTCTCCTGAGACTCTACGCTAGGCAGCCGCCGCCCGCCGCCG

Reverse complement sequence

CGGCGGCGGGCGGCGGCTGCCTAGCGTAGAGTCTCAGGAGAGGAAGGGCGCAGAACGCGACTTGGGCGGATCGAACCTGGCCTGTGTTGACCTCGCGGGA[G/T]
CACCGAAATAGGCTAAAATGCCCTTTCCCGTTAATGTTATAAAAGTCTAAACTACCCATTACAATCAATGGTTAGATTTGATTTTTACTACACTACTACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 29.00% 0.17% 0.00% NA
All Indica  2759 55.70% 44.00% 0.29% 0.00% NA
All Japonica  1512 90.60% 9.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 16.50% 83.20% 0.34% 0.00% NA
Indica II  465 77.60% 22.40% 0.00% 0.00% NA
Indica III  913 69.60% 30.30% 0.11% 0.00% NA
Indica Intermediate  786 56.40% 43.00% 0.64% 0.00% NA
Temperate Japonica  767 84.90% 15.10% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103472849 C -> A LOC_Os01g07350.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:84.524; most accessible tissue: Zhenshan97 root, score: 94.278 N N N N
vg0103472849 C -> A LOC_Os01g07360.1 downstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:84.524; most accessible tissue: Zhenshan97 root, score: 94.278 N N N N
vg0103472849 C -> A LOC_Os01g07360.3 downstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:84.524; most accessible tissue: Zhenshan97 root, score: 94.278 N N N N
vg0103472849 C -> A LOC_Os01g07360.4 downstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:84.524; most accessible tissue: Zhenshan97 root, score: 94.278 N N N N
vg0103472849 C -> A LOC_Os01g07360.2 downstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:84.524; most accessible tissue: Zhenshan97 root, score: 94.278 N N N N
vg0103472849 C -> A LOC_Os01g07350-LOC_Os01g07360 intergenic_region ; MODIFIER silent_mutation Average:84.524; most accessible tissue: Zhenshan97 root, score: 94.278 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103472849 C A -0.05 0.03 0.02 0.02 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103472849 NA 3.41E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103472849 NA 2.51E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 7.27E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 2.50E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 7.41E-07 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 2.17E-06 1.95E-10 mr1693 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 2.07E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 2.61E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 1.76E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 9.77E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 2.09E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 5.56E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472849 NA 1.96E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251