Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103429839:

Variant ID: vg0103429839 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3429839
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGCGGCCCGTCTGCGGGTGCGCGCTGCTGCCGGGCCGAGATGCCTCCGGCCCATATGAGGCCTGCTTATTGGTTAGCGATCCAAATCTGGAAAAAGTC[C/T]
ACTTTGACTCCCTTAAATGTAAAACGAATCTAATTTGTACCCCTCAACCAGAAAACCGGTTAGAACGACTCCCCCAATTACTAAAACCGGTACAAATTGA

Reverse complement sequence

TCAATTTGTACCGGTTTTAGTAATTGGGGGAGTCGTTCTAACCGGTTTTCTGGTTGAGGGGTACAAATTAGATTCGTTTTACATTTAAGGGAGTCAAAGT[G/A]
GACTTTTTCCAGATTTGGATCGCTAACCAATAAGCAGGCCTCATATGGGCCGGAGGCATCTCGGCCCGGCAGCAGCGCGCACCCGCAGACGGGCCGCACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 36.90% 0.74% 2.71% NA
All Indica  2759 77.00% 21.70% 0.87% 0.43% NA
All Japonica  1512 41.90% 51.10% 0.33% 6.75% NA
Aus  269 4.50% 90.30% 0.37% 4.83% NA
Indica I  595 94.80% 4.90% 0.34% 0.00% NA
Indica II  465 92.70% 7.30% 0.00% 0.00% NA
Indica III  913 59.80% 37.90% 1.75% 0.55% NA
Indica Intermediate  786 74.30% 24.00% 0.76% 0.89% NA
Temperate Japonica  767 23.30% 64.50% 0.13% 11.99% NA
Tropical Japonica  504 71.40% 28.00% 0.40% 0.20% NA
Japonica Intermediate  241 39.00% 56.40% 0.83% 3.73% NA
VI/Aromatic  96 0.00% 95.80% 4.17% 0.00% NA
Intermediate  90 54.40% 43.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103429839 C -> T LOC_Os01g07260.1 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:99.496; most accessible tissue: Zhenshan97 root, score: 99.933 N N N N
vg0103429839 C -> T LOC_Os01g07270.1 upstream_gene_variant ; 710.0bp to feature; MODIFIER silent_mutation Average:99.496; most accessible tissue: Zhenshan97 root, score: 99.933 N N N N
vg0103429839 C -> T LOC_Os01g07250.1 downstream_gene_variant ; 4280.0bp to feature; MODIFIER silent_mutation Average:99.496; most accessible tissue: Zhenshan97 root, score: 99.933 N N N N
vg0103429839 C -> T LOC_Os01g07280.1 downstream_gene_variant ; 1767.0bp to feature; MODIFIER silent_mutation Average:99.496; most accessible tissue: Zhenshan97 root, score: 99.933 N N N N
vg0103429839 C -> T LOC_Os01g07260-LOC_Os01g07270 intergenic_region ; MODIFIER silent_mutation Average:99.496; most accessible tissue: Zhenshan97 root, score: 99.933 N N N N
vg0103429839 C -> DEL N N silent_mutation Average:99.496; most accessible tissue: Zhenshan97 root, score: 99.933 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103429839 C T -0.01 0.02 0.01 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103429839 NA 3.24E-07 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103429839 NA 1.61E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103429839 NA 7.01E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103429839 2.36E-06 6.77E-08 mr1713_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103429839 NA 4.81E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103429839 1.05E-06 1.09E-07 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103429839 NA 5.54E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251