\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103410032:

Variant ID: vg0103410032 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 3410032
Reference Allele: AAlternative Allele: AT,T,AAT,AAAT
Primary Allele: ATSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTGCGCCGACGCATTGCAGAAACACACCAATTAATGGATGCCAGCAATTTTCTGAAACTAAATATTCTTGGTGTTTTTTTCTTTCCGTTCAAAAAAAA[A/AT,T,AAT,AAAT]
ATTCTTGGTGTTTTTGGAAATTCTTAAATAAAATATGTGATAGGTATGTGTCTCTTTAATTTTTTTTAATAAAAAGAGAGAAAAATAGATACTATATACG

Reverse complement sequence

CGTATATAGTATCTATTTTTCTCTCTTTTTATTAAAAAAAATTAAAGAGACACATACCTATCACATATTTTATTTAAGAATTTCCAAAAACACCAAGAAT[T/AT,A,ATT,ATTT]
TTTTTTTTGAACGGAAAGAAAAAAACACCAAGAATATTTAGTTTCAGAAAATTGCTGGCATCCATTAATTGGTGTGTTTCTGCAATGCGTCGGCGCAAGT

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 23.50% 0.32% 0.00% T: 16.14%; AAT: 0.44%; AAAT: 0.13%
All Indica  2759 92.90% 4.00% 0.07% 0.00% T: 2.39%; AAT: 0.69%
All Japonica  1512 11.00% 43.70% 0.73% 0.00% T: 44.25%; AAAT: 0.26%
Aus  269 6.70% 88.10% 0.00% 0.00% T: 4.83%; AAAT: 0.37%
Indica I  595 97.80% 0.20% 0.00% 0.00% T: 2.02%
Indica II  465 92.70% 5.40% 0.00% 0.00% T: 1.94%
Indica III  913 89.70% 6.10% 0.22% 0.00% T: 2.30%; AAT: 1.64%
Indica Intermediate  786 92.90% 3.60% 0.00% 0.00% T: 3.05%; AAT: 0.51%
Temperate Japonica  767 17.20% 52.80% 0.91% 0.00% T: 29.07%
Tropical Japonica  504 4.00% 27.00% 0.20% 0.00% T: 68.45%; AAAT: 0.40%
Japonica Intermediate  241 6.20% 49.80% 1.24% 0.00% T: 41.91%; AAAT: 0.83%
VI/Aromatic  96 18.80% 77.10% 1.04% 0.00% AAT: 2.08%; AAAT: 1.04%
Intermediate  90 50.00% 32.20% 1.11% 0.00% T: 16.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103410032 A -> T LOC_Os01g07212.1 downstream_gene_variant ; 2674.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> T LOC_Os01g07240.1 downstream_gene_variant ; 4627.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> T LOC_Os01g07212-LOC_Os01g07240 intergenic_region ; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AAAT LOC_Os01g07212.1 downstream_gene_variant ; 2675.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AAAT LOC_Os01g07240.1 downstream_gene_variant ; 4626.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AAAT LOC_Os01g07212-LOC_Os01g07240 intergenic_region ; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AT LOC_Os01g07212.1 downstream_gene_variant ; 2675.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AT LOC_Os01g07240.1 downstream_gene_variant ; 4626.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AT LOC_Os01g07212-LOC_Os01g07240 intergenic_region ; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AAT LOC_Os01g07212.1 downstream_gene_variant ; 2675.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AAT LOC_Os01g07240.1 downstream_gene_variant ; 4626.0bp to feature; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N
vg0103410032 A -> AAT LOC_Os01g07212-LOC_Os01g07240 intergenic_region ; MODIFIER silent_mutation Average:58.074; most accessible tissue: Callus, score: 75.445 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103410032 NA 2.19E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103410032 NA 6.79E-07 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 6.16E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.57E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 9.75E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 1.31E-06 NA mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 9.29E-08 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.90E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 5.08E-06 NA mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 1.21E-06 1.21E-06 mr1130 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 6.02E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.29E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 7.02E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.60E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.81E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 1.93E-06 NA mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.98E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.68E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.47E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 7.41E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.86E-09 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.45E-07 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.78E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 6.10E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.39E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 2.11E-06 8.74E-07 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.54E-08 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 5.40E-06 5.40E-06 mr1290 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 2.52E-06 8.65E-08 mr1292 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 4.12E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.70E-07 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 9.54E-06 9.53E-06 mr1357 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.67E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.36E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.10E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 9.69E-06 9.69E-06 mr1476 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.16E-07 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 8.38E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.80E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.76E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 6.24E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.82E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.72E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 6.31E-06 mr1614 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.13E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.02E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.96E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.48E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.84E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 2.17E-06 1.28E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.33E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.10E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 8.86E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 2.22E-06 2.22E-06 mr1752 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.32E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 4.89E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.12E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 7.18E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 7.20E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.54E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.31E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 1.28E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 7.19E-06 mr1921 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 6.02E-06 6.01E-06 mr1967 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 5.55E-06 5.55E-06 mr1967 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 5.95E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.70E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.65E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 2.92E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103410032 NA 3.38E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251