\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103409480:

Variant ID: vg0103409480 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3409480
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTATGCGTCAAGCATGATTTAAACTTGAGAACTTTAGCTCCCATATCATACCGCGTAAAAGCTTTTTTTCAGTAGTTTCCTTTTCCTTTTCTATTTG[G/A]
GTCTTTTCTCCCTTCCTCCGGCATAGGCATGTCTGGCTGATTGCGTTGTGCAACAAAACATCTTTTCCCTTCTAATACATTGACGTGCAATCCTTTTGCG

Reverse complement sequence

CGCAAAAGGATTGCACGTCAATGTATTAGAAGGGAAAAGATGTTTTGTTGCACAACGCAATCAGCCAGACATGCCTATGCCGGAGGAAGGGAGAAAAGAC[C/T]
CAAATAGAAAAGGAAAAGGAAACTACTGAAAAAAAGCTTTTACGCGGTATGATATGGGAGCTAAAGTTCTCAAGTTTAAATCATGCTTGACGCATAATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.10% 0.11% 0.00% NA
All Indica  2759 76.80% 23.10% 0.18% 0.00% NA
All Japonica  1512 41.90% 58.10% 0.00% 0.00% NA
Aus  269 4.50% 95.50% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.17% 0.00% NA
Indica II  465 93.30% 6.50% 0.22% 0.00% NA
Indica III  913 58.10% 41.80% 0.11% 0.00% NA
Indica Intermediate  786 74.20% 25.60% 0.25% 0.00% NA
Temperate Japonica  767 23.20% 76.80% 0.00% 0.00% NA
Tropical Japonica  504 71.80% 28.20% 0.00% 0.00% NA
Japonica Intermediate  241 38.60% 61.40% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103409480 G -> A LOC_Os01g07212.1 downstream_gene_variant ; 2122.0bp to feature; MODIFIER silent_mutation Average:50.684; most accessible tissue: Callus, score: 84.656 N N N N
vg0103409480 G -> A LOC_Os01g07212-LOC_Os01g07240 intergenic_region ; MODIFIER silent_mutation Average:50.684; most accessible tissue: Callus, score: 84.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103409480 7.37E-06 3.01E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 NA 3.71E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 NA 3.22E-09 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 2.63E-08 NA mr1719 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 NA 7.16E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 NA 9.66E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 NA 3.92E-07 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103409480 NA 4.62E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251