\
| Variant ID: vg0103409480 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3409480 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAATTATGCGTCAAGCATGATTTAAACTTGAGAACTTTAGCTCCCATATCATACCGCGTAAAAGCTTTTTTTCAGTAGTTTCCTTTTCCTTTTCTATTTG[G/A]
GTCTTTTCTCCCTTCCTCCGGCATAGGCATGTCTGGCTGATTGCGTTGTGCAACAAAACATCTTTTCCCTTCTAATACATTGACGTGCAATCCTTTTGCG
CGCAAAAGGATTGCACGTCAATGTATTAGAAGGGAAAAGATGTTTTGTTGCACAACGCAATCAGCCAGACATGCCTATGCCGGAGGAAGGGAGAAAAGAC[C/T]
CAAATAGAAAAGGAAAAGGAAACTACTGAAAAAAAGCTTTTACGCGGTATGATATGGGAGCTAAAGTTCTCAAGTTTAAATCATGCTTGACGCATAATTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 40.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 76.80% | 23.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 41.90% | 58.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 4.50% | 95.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 3.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 58.10% | 41.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.20% | 25.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 23.20% | 76.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.60% | 61.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103409480 | G -> A | LOC_Os01g07212.1 | downstream_gene_variant ; 2122.0bp to feature; MODIFIER | silent_mutation | Average:50.684; most accessible tissue: Callus, score: 84.656 | N | N | N | N |
| vg0103409480 | G -> A | LOC_Os01g07212-LOC_Os01g07240 | intergenic_region ; MODIFIER | silent_mutation | Average:50.684; most accessible tissue: Callus, score: 84.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103409480 | 7.37E-06 | 3.01E-07 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | NA | 3.71E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | NA | 3.22E-09 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | 2.63E-08 | NA | mr1719 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | NA | 7.16E-12 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | NA | 9.66E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | NA | 3.92E-07 | mr1713_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103409480 | NA | 4.62E-06 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |