Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103396097:

Variant ID: vg0103396097 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3396097
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTCAGGACAGACTACCTCGACAAGCCCCCACGGCGTCCTCTCCTTCTCGGCTCTCGCCGCCGACGATTCCTTCCGCCGTGGCTCGTCGCCGCGCTCAG[G/T]
TACCTTGACGACGACGGCGATCTCTCCATGGCAGAGAAGAAGAAGAGGAGGAGGAGGAAGCTCCTTCTCGCGACCACTGCGCAGGAGGCCCACATCTACG

Reverse complement sequence

CGTAGATGTGGGCCTCCTGCGCAGTGGTCGCGAGAAGGAGCTTCCTCCTCCTCCTCTTCTTCTTCTCTGCCATGGAGAGATCGCCGTCGTCGTCAAGGTA[C/A]
CTGAGCGCGGCGACGAGCCACGGCGGAAGGAATCGTCGGCGGCGAGAGCCGAGAAGGAGAGGACGCCGTGGGGGCTTGTCGAGGTAGTCTGTCCTGAAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	39.40%	0.55%	0.00%	NA
All Indica	2759	77.60%	22.10%	0.29%	0.00%	NA
All Japonica	1512	41.50%	58.50%	0.00%	0.00%	NA
Aus	269	3.70%	91.40%	4.83%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	58.40%	41.30%	0.33%	0.00%	NA
Indica Intermediate	786	76.50%	22.90%	0.64%	0.00%	NA
Temperate Japonica	767	23.20%	76.80%	0.00%	0.00%	NA
Tropical Japonica	504	70.80%	29.20%	0.00%	0.00%	NA
Japonica Intermediate	241	38.20%	61.80%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	48.90%	45.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103396097	G -> T	LOC_Os01g07190.1	missense_variant ; p.Arg112Ser; MODERATE	nonsynonymous_codon ; R112S	Average:80.344; most accessible tissue: Zhenshan97 flower, score: 91.224	unknown	unknown	TOLERATED	0.87

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0103396097	G	T	-0.02	-0.01	-0.01	-0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103396097	NA	2.21E-07	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	1.02E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	2.86E-07	2.86E-07	mr1217_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	2.91E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	3.69E-06	mr1239_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	9.37E-06	mr1266_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	9.61E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	5.05E-06	5.05E-06	mr1365_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	5.27E-06	NA	mr1607_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	1.62E-06	2.00E-07	mr1713_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	2.15E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	6.43E-06	5.94E-06	mr1731_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	6.53E-06	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	8.84E-06	mr1741_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	4.58E-06	3.28E-06	mr1785_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	8.01E-06	6.22E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	NA	5.17E-06	mr1837_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	5.35E-06	5.35E-06	mr1852_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103396097	6.79E-06	6.79E-06	mr1953_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251