\
| Variant ID: vg0103392222 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3392222 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )
TGTCGGCACGGTCGCGCACCACGTCGACCATCACCTTGGAGTCGCCCTCCGCCCAAATGAGGCGCCACCCGTTCTGCACCGCCAGCTCGAGCCCTCGCCT[G/A]
AGCACGGTGCTGATGCTCGCGATCCCGGTCGAGTGCTTGGAAGACCCGTCGAAGTTGAGCTTCATCCACCCCTCCTCCGGCTTCCTCCAAGTCCTCGTCG
CGACGAGGACTTGGAGGAAGCCGGAGGAGGGGTGGATGAAGCTCAACTTCGACGGGTCTTCCAAGCACTCGACCGGGATCGCGAGCATCAGCACCGTGCT[C/T]
AGGCGAGGGCTCGAGCTGGCGGTGCAGAACGGGTGGCGCCTCATTTGGGCGGAGGGCGACTCCAAGGTGATGGTCGACGTGGTGCGCGACCGTGCCGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 37.90% | 0.61% | 0.25% | NA |
| All Indica | 2759 | 41.00% | 58.20% | 0.43% | 0.36% | NA |
| All Japonica | 1512 | 90.20% | 9.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 91.40% | 3.70% | 4.83% | 0.00% | NA |
| Indica I | 595 | 60.50% | 38.30% | 0.34% | 0.84% | NA |
| Indica II | 465 | 14.60% | 84.70% | 0.00% | 0.65% | NA |
| Indica III | 913 | 45.20% | 54.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 37.00% | 61.80% | 0.89% | 0.25% | NA |
| Temperate Japonica | 767 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 30.00% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103392222 | G -> A | LOC_Os01g07180.1 | synonymous_variant ; p.Leu170Leu; LOW | synonymous_codon | Average:74.077; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0103392222 | G -> DEL | LOC_Os01g07180.1 | N | frameshift_variant | Average:74.077; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103392222 | NA | 2.67E-11 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 1.02E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 4.85E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 2.59E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | 3.13E-06 | 3.13E-06 | mr1461 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 5.56E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 6.46E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | 6.12E-06 | NA | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 1.73E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 1.46E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 1.93E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 9.15E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 2.21E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 3.78E-09 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 6.72E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103392222 | NA | 5.44E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |