\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103392222:

Variant ID: vg0103392222 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3392222
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCGGCACGGTCGCGCACCACGTCGACCATCACCTTGGAGTCGCCCTCCGCCCAAATGAGGCGCCACCCGTTCTGCACCGCCAGCTCGAGCCCTCGCCT[G/A]
AGCACGGTGCTGATGCTCGCGATCCCGGTCGAGTGCTTGGAAGACCCGTCGAAGTTGAGCTTCATCCACCCCTCCTCCGGCTTCCTCCAAGTCCTCGTCG

Reverse complement sequence

CGACGAGGACTTGGAGGAAGCCGGAGGAGGGGTGGATGAAGCTCAACTTCGACGGGTCTTCCAAGCACTCGACCGGGATCGCGAGCATCAGCACCGTGCT[C/T]
AGGCGAGGGCTCGAGCTGGCGGTGCAGAACGGGTGGCGCCTCATTTGGGCGGAGGGCGACTCCAAGGTGATGGTCGACGTGGTGCGCGACCGTGCCGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 37.90% 0.61% 0.25% NA
All Indica  2759 41.00% 58.20% 0.43% 0.36% NA
All Japonica  1512 90.20% 9.70% 0.00% 0.07% NA
Aus  269 91.40% 3.70% 4.83% 0.00% NA
Indica I  595 60.50% 38.30% 0.34% 0.84% NA
Indica II  465 14.60% 84.70% 0.00% 0.65% NA
Indica III  913 45.20% 54.40% 0.33% 0.00% NA
Indica Intermediate  786 37.00% 61.80% 0.89% 0.25% NA
Temperate Japonica  767 84.40% 15.60% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.40% 0.00% 0.20% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 64.40% 30.00% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103392222 G -> A LOC_Os01g07180.1 synonymous_variant ; p.Leu170Leu; LOW synonymous_codon Average:74.077; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0103392222 G -> DEL LOC_Os01g07180.1 N frameshift_variant Average:74.077; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103392222 NA 2.67E-11 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 1.02E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 4.85E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 2.59E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 3.13E-06 3.13E-06 mr1461 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 5.56E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 6.46E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 6.12E-06 NA mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 1.73E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 1.46E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 1.93E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 9.15E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 2.21E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 3.78E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 6.72E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103392222 NA 5.44E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251