\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103390736:

Variant ID: vg0103390736 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3390736
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGAGGGCCGCCGCGCGCCGCCAGCTCTTGTTGGCAAGGGCCGCGCGGACCACATCCCTCGGACACAGACACTTCAGGATGGATCGGAGCAGGAAATC[G/A]
TCCGTCAGCACGGCCGCCATCGCCGCCGCCGCCGGTGGCTCTTCGTCGCCTTCCATTGCCGAGATTTAGGGTTTTTCTTCTCTCTCTCTCTGTTTTTTTT

Reverse complement sequence

AAAAAAAACAGAGAGAGAGAGAAGAAAAACCCTAAATCTCGGCAATGGAAGGCGACGAAGAGCCACCGGCGGCGGCGGCGATGGCGGCCGTGCTGACGGA[C/T]
GATTTCCTGCTCCGATCCATCCTGAAGTGTCTGTGTCCGAGGGATGTGGTCCGCGCGGCCCTTGCCAACAAGAGCTGGCGGCGCGCGGCGGCCCTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 7.80% 0.85% 0.00% NA
All Indica  2759 96.30% 3.50% 0.18% 0.00% NA
All Japonica  1512 99.10% 0.10% 0.79% 0.00% NA
Aus  269 11.20% 82.20% 6.69% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 94.30% 5.70% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.80% 0.64% 0.00% NA
Temperate Japonica  767 99.00% 0.00% 1.04% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 1.24% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 83.30% 11.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103390736 G -> A LOC_Os01g07170.1 synonymous_variant ; p.Asp7Asp; LOW synonymous_codon Average:91.693; most accessible tissue: Minghui63 flower, score: 97.098 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103390736 G A 0.06 0.02 0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103390736 NA 5.66E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 5.65E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 7.96E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 6.19E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 3.29E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 1.82E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 1.05E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 2.47E-06 2.45E-11 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103390736 NA 4.10E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251