Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103370208:

Variant ID: vg0103370208 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3370208
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TGAATATGAGCAATGCTAGAAAGTCTTACATTGTGAAACGGATGGAGTAATTAACAACCAAATATATTAATTATTGCTAATCGATTAATTTGAACATATA[C/T]
ACTCATCCAGCACCTTTGTGAAATATTCCCTTTTCCGACCACCCTATCCATCATTGCACATCAACCAAACATGCATAAAAGTTCCATCAACATTTTTTAT

Reverse complement sequence

ATAAAAAATGTTGATGGAACTTTTATGCATGTTTGGTTGATGTGCAATGATGGATAGGGTGGTCGGAAAAGGGAATATTTCACAAAGGTGCTGGATGAGT[G/A]
TATATGTTCAAATTAATCGATTAGCAATAATTAATATATTTGGTTGTTAATTACTCCATCCGTTTCACAATGTAAGACTTTCTAGCATTGCTCATATTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	41.00%	0.70%	0.00%	NA
All Indica	2759	39.10%	60.30%	0.62%	0.00%	NA
All Japonica	1512	84.70%	15.30%	0.00%	0.00%	NA
Aus	269	91.40%	3.70%	4.83%	0.00%	NA
Indica I	595	59.00%	40.50%	0.50%	0.00%	NA
Indica II	465	15.10%	84.70%	0.22%	0.00%	NA
Indica III	913	42.40%	57.30%	0.33%	0.00%	NA
Indica Intermediate	786	34.40%	64.40%	1.27%	0.00%	NA
Temperate Japonica	767	83.70%	16.30%	0.00%	0.00%	NA
Tropical Japonica	504	84.70%	15.30%	0.00%	0.00%	NA
Japonica Intermediate	241	87.60%	12.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	62.20%	34.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103370208	C -> T	LOC_Os01g07140.1	upstream_gene_variant ; 3887.0bp to feature; MODIFIER	silent_mutation	Average:53.164; most accessible tissue: Callus, score: 76.153	N	N	N	N
vg0103370208	C -> T	LOC_Os01g07140.2	upstream_gene_variant ; 2545.0bp to feature; MODIFIER	silent_mutation	Average:53.164; most accessible tissue: Callus, score: 76.153	N	N	N	N
vg0103370208	C -> T	LOC_Os01g07140-LOC_Os01g07150	intergenic_region ; MODIFIER	silent_mutation	Average:53.164; most accessible tissue: Callus, score: 76.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103370208	7.57E-06	7.57E-06	mr1054	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	NA	3.98E-11	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	NA	5.30E-06	mr1287	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	5.74E-07	5.74E-07	mr1327	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	4.63E-06	NA	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	NA	3.15E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	4.30E-06	4.30E-06	mr1372	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	5.53E-06	6.26E-06	mr1398	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	NA	2.54E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208	2.90E-08	2.90E-08	mr1967	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251