\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103370208:

Variant ID: vg0103370208 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3370208
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATATGAGCAATGCTAGAAAGTCTTACATTGTGAAACGGATGGAGTAATTAACAACCAAATATATTAATTATTGCTAATCGATTAATTTGAACATATA[C/T]
ACTCATCCAGCACCTTTGTGAAATATTCCCTTTTCCGACCACCCTATCCATCATTGCACATCAACCAAACATGCATAAAAGTTCCATCAACATTTTTTAT

Reverse complement sequence

ATAAAAAATGTTGATGGAACTTTTATGCATGTTTGGTTGATGTGCAATGATGGATAGGGTGGTCGGAAAAGGGAATATTTCACAAAGGTGCTGGATGAGT[G/A]
TATATGTTCAAATTAATCGATTAGCAATAATTAATATATTTGGTTGTTAATTACTCCATCCGTTTCACAATGTAAGACTTTCTAGCATTGCTCATATTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.00% 0.70% 0.00% NA
All Indica  2759 39.10% 60.30% 0.62% 0.00% NA
All Japonica  1512 84.70% 15.30% 0.00% 0.00% NA
Aus  269 91.40% 3.70% 4.83% 0.00% NA
Indica I  595 59.00% 40.50% 0.50% 0.00% NA
Indica II  465 15.10% 84.70% 0.22% 0.00% NA
Indica III  913 42.40% 57.30% 0.33% 0.00% NA
Indica Intermediate  786 34.40% 64.40% 1.27% 0.00% NA
Temperate Japonica  767 83.70% 16.30% 0.00% 0.00% NA
Tropical Japonica  504 84.70% 15.30% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103370208 C -> T LOC_Os01g07140.1 upstream_gene_variant ; 3887.0bp to feature; MODIFIER silent_mutation Average:53.164; most accessible tissue: Callus, score: 76.153 N N N N
vg0103370208 C -> T LOC_Os01g07140.2 upstream_gene_variant ; 2545.0bp to feature; MODIFIER silent_mutation Average:53.164; most accessible tissue: Callus, score: 76.153 N N N N
vg0103370208 C -> T LOC_Os01g07140-LOC_Os01g07150 intergenic_region ; MODIFIER silent_mutation Average:53.164; most accessible tissue: Callus, score: 76.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103370208 7.57E-06 7.57E-06 mr1054 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 NA 3.98E-11 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 NA 5.30E-06 mr1287 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 5.74E-07 5.74E-07 mr1327 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 4.63E-06 NA mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 NA 3.15E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 4.30E-06 4.30E-06 mr1372 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 5.53E-06 6.26E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 NA 2.54E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103370208 2.90E-08 2.90E-08 mr1967 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251