\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103324572:

Variant ID: vg0103324572 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 3324572
Reference Allele: GAlternative Allele: GCA
Primary Allele: GCASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTCCTTCATATGATGGTGGGTATGGTGGTCGGCCTATGCCTGGGGGTGGAGGCCCTGGTGCACCTCCACCCTATCATGGTGGTGGTGGTGGTGGTGGT[G/GCA]
GCGGCGGCGGTGGCGGCGGATACACTGGCAGTGCTGCTCCAGAGCCAGCTGCAAAGGTTAAGCAGTGTGATGCAAACTGTGATGAGACTTGTGATAATGC

Reverse complement sequence

GCATTATCACAAGTCTCATCACAGTTTGCATCACACTGCTTAACCTTTGCAGCTGGCTCTGGAGCAGCACTGCCAGTGTATCCGCCGCCACCGCCGCCGC[C/TGC]
ACCACCACCACCACCACCACCATGATAGGGTGGAGGTGCACCAGGGCCTCCACCCCCAGGCATAGGCCGACCACCATACCCACCATCATATGAAGGAGGT

Allele Frequencies:

Populations Population SizeFrequency of GCA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 48.60% 0.04% 0.85% NA
All Indica  2759 76.10% 22.40% 0.07% 1.45% NA
All Japonica  1512 15.90% 84.10% 0.00% 0.00% NA
Aus  269 3.70% 96.30% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 91.40% 8.20% 0.00% 0.43% NA
Indica III  913 53.90% 42.40% 0.11% 3.61% NA
Indica Intermediate  786 77.50% 21.80% 0.13% 0.64% NA
Temperate Japonica  767 17.30% 82.70% 0.00% 0.00% NA
Tropical Japonica  504 15.90% 84.10% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103324572 G -> DEL LOC_Os01g07070.1 N frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> DEL LOC_Os01g07070.4 N frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> DEL LOC_Os01g07070.2 N frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> DEL LOC_Os01g07070.3 N frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> GCA LOC_Os01g07070.1 frameshift_variant ; p.Gly329fs; HIGH frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> GCA LOC_Os01g07070.2 frameshift_variant ; p.Gly329fs; HIGH frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> GCA LOC_Os01g07070.4 frameshift_variant ; p.Gly329fs; HIGH frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N
vg0103324572 G -> GCA LOC_Os01g07070.3 frameshift_variant ; p.Gly329fs; HIGH frameshift_variant Average:84.303; most accessible tissue: Minghui63 flag leaf, score: 92.187 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103324572 G GCA -0.02 -0.04 -0.06 0.0 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103324572 NA 4.13E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103324572 NA 4.09E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103324572 6.57E-06 6.57E-06 mr1327 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103324572 8.10E-07 3.79E-06 mr1328 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103324572 4.03E-06 4.03E-06 mr1529 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251