\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103252222:

Variant ID: vg0103252222 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3252222
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAACACTAGGTCTAGCAGCAACCAATTTATCTTATCACATACCGTCCTCATTTGCCAATCTCAAGTCCTTGAAGCGTTTGGGTATGAGCACGGCACGAA[C/T]
TTCCAAGGAGCTGCCCTCTTTATTAGATAAGCTTCCTTCATTGACAGAACTGGAATTGCAAGGATCGGAATCAGGCTTGGAGAAGGCGGTATTATCTTGG

Reverse complement sequence

CCAAGATAATACCGCCTTCTCCAAGCCTGATTCCGATCCTTGCAATTCCAGTTCTGTCAATGAAGGAAGCTTATCTAATAAAGAGGGCAGCTCCTTGGAA[G/A]
TTCGTGCCGTGCTCATACCCAAACGCTTCAAGGACTTGAGATTGGCAAATGAGGACGGTATGTGATAAGATAAATTGGTTGCTGCTAGACCTAGTGTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 25.90% 0.06% 12.44% NA
All Indica  2759 92.10% 5.90% 0.07% 1.85% NA
All Japonica  1512 19.10% 46.00% 0.07% 34.79% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 97.80% 0.50% 0.17% 1.51% NA
Indica II  465 92.50% 6.20% 0.00% 1.29% NA
Indica III  913 87.30% 10.10% 0.11% 2.52% NA
Indica Intermediate  786 93.30% 5.10% 0.00% 1.65% NA
Temperate Japonica  767 19.00% 75.00% 0.13% 5.87% NA
Tropical Japonica  504 18.70% 5.60% 0.00% 75.79% NA
Japonica Intermediate  241 20.30% 38.60% 0.00% 41.08% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 56.70% 31.10% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103252222 C -> T LOC_Os01g06870.1 missense_variant ; p.Thr340Ile; MODERATE nonsynonymous_codon ; T340I Average:60.141; most accessible tissue: Zhenshan97 root, score: 82.912 unknown unknown TOLERATED 0.52
vg0103252222 C -> DEL LOC_Os01g06870.1 N frameshift_variant Average:60.141; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103252222 NA 3.21E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 9.20E-11 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 1.09E-18 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 7.15E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 8.93E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 4.14E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 9.02E-06 2.23E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 2.42E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 9.18E-10 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 3.53E-06 NA mr1328 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 1.22E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 2.08E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 7.28E-06 6.01E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 1.26E-12 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 5.87E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 2.07E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 1.94E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 3.44E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 6.20E-07 6.20E-07 mr1967 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 8.92E-15 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 5.31E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 1.05E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103252222 NA 9.58E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251