\
| Variant ID: vg0103252222 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3252222 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAAACACTAGGTCTAGCAGCAACCAATTTATCTTATCACATACCGTCCTCATTTGCCAATCTCAAGTCCTTGAAGCGTTTGGGTATGAGCACGGCACGAA[C/T]
TTCCAAGGAGCTGCCCTCTTTATTAGATAAGCTTCCTTCATTGACAGAACTGGAATTGCAAGGATCGGAATCAGGCTTGGAGAAGGCGGTATTATCTTGG
CCAAGATAATACCGCCTTCTCCAAGCCTGATTCCGATCCTTGCAATTCCAGTTCTGTCAATGAAGGAAGCTTATCTAATAAAGAGGGCAGCTCCTTGGAA[G/A]
TTCGTGCCGTGCTCATACCCAAACGCTTCAAGGACTTGAGATTGGCAAATGAGGACGGTATGTGATAAGATAAATTGGTTGCTGCTAGACCTAGTGTTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 25.90% | 0.06% | 12.44% | NA |
| All Indica | 2759 | 92.10% | 5.90% | 0.07% | 1.85% | NA |
| All Japonica | 1512 | 19.10% | 46.00% | 0.07% | 34.79% | NA |
| Aus | 269 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.50% | 0.17% | 1.51% | NA |
| Indica II | 465 | 92.50% | 6.20% | 0.00% | 1.29% | NA |
| Indica III | 913 | 87.30% | 10.10% | 0.11% | 2.52% | NA |
| Indica Intermediate | 786 | 93.30% | 5.10% | 0.00% | 1.65% | NA |
| Temperate Japonica | 767 | 19.00% | 75.00% | 0.13% | 5.87% | NA |
| Tropical Japonica | 504 | 18.70% | 5.60% | 0.00% | 75.79% | NA |
| Japonica Intermediate | 241 | 20.30% | 38.60% | 0.00% | 41.08% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 31.10% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103252222 | C -> T | LOC_Os01g06870.1 | missense_variant ; p.Thr340Ile; MODERATE | nonsynonymous_codon ; T340I | Average:60.141; most accessible tissue: Zhenshan97 root, score: 82.912 | unknown | unknown | TOLERATED | 0.52 |
| vg0103252222 | C -> DEL | LOC_Os01g06870.1 | N | frameshift_variant | Average:60.141; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103252222 | NA | 3.21E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 9.20E-11 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 1.09E-18 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 7.15E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 8.93E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 4.14E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | 9.02E-06 | 2.23E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 2.42E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 9.18E-10 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | 3.53E-06 | NA | mr1328 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 1.22E-11 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 2.08E-07 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | 7.28E-06 | 6.01E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 1.26E-12 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 5.87E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 2.07E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 1.94E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 3.44E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | 6.20E-07 | 6.20E-07 | mr1967 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 8.92E-15 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 5.31E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 1.05E-22 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103252222 | NA | 9.58E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |