| Variant ID: vg0103243562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3243562 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.05, others allele: 0.00, population size: 163. )
TTCATACAACAACTTGACTGGAAGAATACCGCAGGGCAACCAGTTTGGGTCATTTAGCAGCAGCTCGTTTGAAGGCAATGCCAACCTCTGTGGAAAGCCG[T/C]
TGTCTAAACAATGTGATACTCCAGGCTCAACATCTCGAAATGCATCAGCTACTTCAGAAACCAGCAGTTTCTGGCAGGACAGACTTGGCGTGATCCTTTT
AAAAGGATCACGCCAAGTCTGTCCTGCCAGAAACTGCTGGTTTCTGAAGTAGCTGATGCATTTCGAGATGTTGAGCCTGGAGTATCACATTGTTTAGACA[A/G]
CGGCTTTCCACAGAGGTTGGCATTGCCTTCAAACGAGCTGCTGCTAAATGACCCAAACTGGTTGCCCTGCGGTATTCTTCCAGTCAAGTTGTTGTATGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.40% | 8.70% | 2.35% | 11.55% | NA |
| All Indica | 2759 | 96.20% | 2.40% | 0.11% | 1.27% | NA |
| All Japonica | 1512 | 38.50% | 21.50% | 6.88% | 33.13% | NA |
| Aus | 269 | 94.10% | 5.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 0.00% | 1.51% | NA |
| Indica II | 465 | 98.10% | 0.60% | 0.22% | 1.08% | NA |
| Indica III | 913 | 93.60% | 5.10% | 0.11% | 1.10% | NA |
| Indica Intermediate | 786 | 96.30% | 2.20% | 0.13% | 1.40% | NA |
| Temperate Japonica | 767 | 49.80% | 36.10% | 8.47% | 5.61% | NA |
| Tropical Japonica | 504 | 22.00% | 1.80% | 4.17% | 72.02% | NA |
| Japonica Intermediate | 241 | 36.90% | 16.20% | 7.47% | 39.42% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 2.20% | 3.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103243562 | T -> DEL | N | N | silent_mutation | Average:58.557; most accessible tissue: Callus, score: 79.26 | N | N | N | N |
| vg0103243562 | T -> C | LOC_Os01g06836.1 | downstream_gene_variant ; 247.0bp to feature; MODIFIER | silent_mutation | Average:58.557; most accessible tissue: Callus, score: 79.26 | N | N | N | N |
| vg0103243562 | T -> C | LOC_Os01g06852.1 | downstream_gene_variant ; 3437.0bp to feature; MODIFIER | silent_mutation | Average:58.557; most accessible tissue: Callus, score: 79.26 | N | N | N | N |
| vg0103243562 | T -> C | LOC_Os01g06836-LOC_Os01g06852 | intergenic_region ; MODIFIER | silent_mutation | Average:58.557; most accessible tissue: Callus, score: 79.26 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103243562 | NA | 4.04E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 5.00E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 4.36E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | 3.81E-06 | NA | mr1289 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | 8.19E-06 | 1.08E-08 | mr1289 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 1.73E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 2.99E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 3.58E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 4.82E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 6.85E-06 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243562 | NA | 4.74E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |