Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103243562:

Variant ID: vg0103243562 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3243562
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.05, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:

TTCATACAACAACTTGACTGGAAGAATACCGCAGGGCAACCAGTTTGGGTCATTTAGCAGCAGCTCGTTTGAAGGCAATGCCAACCTCTGTGGAAAGCCG[T/C]
TGTCTAAACAATGTGATACTCCAGGCTCAACATCTCGAAATGCATCAGCTACTTCAGAAACCAGCAGTTTCTGGCAGGACAGACTTGGCGTGATCCTTTT

Reverse complement sequence

AAAAGGATCACGCCAAGTCTGTCCTGCCAGAAACTGCTGGTTTCTGAAGTAGCTGATGCATTTCGAGATGTTGAGCCTGGAGTATCACATTGTTTAGACA[A/G]
CGGCTTTCCACAGAGGTTGGCATTGCCTTCAAACGAGCTGCTGCTAAATGACCCAAACTGGTTGCCCTGCGGTATTCTTCCAGTCAAGTTGTTGTATGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	8.70%	2.35%	11.55%	NA
All Indica	2759	96.20%	2.40%	0.11%	1.27%	NA
All Japonica	1512	38.50%	21.50%	6.88%	33.13%	NA
Aus	269	94.10%	5.60%	0.37%	0.00%	NA
Indica I	595	98.50%	0.00%	0.00%	1.51%	NA
Indica II	465	98.10%	0.60%	0.22%	1.08%	NA
Indica III	913	93.60%	5.10%	0.11%	1.10%	NA
Indica Intermediate	786	96.30%	2.20%	0.13%	1.40%	NA
Temperate Japonica	767	49.80%	36.10%	8.47%	5.61%	NA
Tropical Japonica	504	22.00%	1.80%	4.17%	72.02%	NA
Japonica Intermediate	241	36.90%	16.20%	7.47%	39.42%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	2.20%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103243562	T -> DEL	N	N	silent_mutation	Average:58.557; most accessible tissue: Callus, score: 79.26	N	N	N	N
vg0103243562	T -> C	LOC_Os01g06836.1	downstream_gene_variant ; 247.0bp to feature; MODIFIER	silent_mutation	Average:58.557; most accessible tissue: Callus, score: 79.26	N	N	N	N
vg0103243562	T -> C	LOC_Os01g06852.1	downstream_gene_variant ; 3437.0bp to feature; MODIFIER	silent_mutation	Average:58.557; most accessible tissue: Callus, score: 79.26	N	N	N	N
vg0103243562	T -> C	LOC_Os01g06836-LOC_Os01g06852	intergenic_region ; MODIFIER	silent_mutation	Average:58.557; most accessible tissue: Callus, score: 79.26	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103243562	NA	4.04E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	5.00E-07	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	4.36E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	3.81E-06	NA	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	8.19E-06	1.08E-08	mr1289	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	1.73E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	2.99E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	3.58E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	4.82E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	6.85E-06	mr1897	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562	NA	4.74E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251