\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103243562:

Variant ID: vg0103243562 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3243562
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.05, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATACAACAACTTGACTGGAAGAATACCGCAGGGCAACCAGTTTGGGTCATTTAGCAGCAGCTCGTTTGAAGGCAATGCCAACCTCTGTGGAAAGCCG[T/C]
TGTCTAAACAATGTGATACTCCAGGCTCAACATCTCGAAATGCATCAGCTACTTCAGAAACCAGCAGTTTCTGGCAGGACAGACTTGGCGTGATCCTTTT

Reverse complement sequence

AAAAGGATCACGCCAAGTCTGTCCTGCCAGAAACTGCTGGTTTCTGAAGTAGCTGATGCATTTCGAGATGTTGAGCCTGGAGTATCACATTGTTTAGACA[A/G]
CGGCTTTCCACAGAGGTTGGCATTGCCTTCAAACGAGCTGCTGCTAAATGACCCAAACTGGTTGCCCTGCGGTATTCTTCCAGTCAAGTTGTTGTATGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 8.70% 2.35% 11.55% NA
All Indica  2759 96.20% 2.40% 0.11% 1.27% NA
All Japonica  1512 38.50% 21.50% 6.88% 33.13% NA
Aus  269 94.10% 5.60% 0.37% 0.00% NA
Indica I  595 98.50% 0.00% 0.00% 1.51% NA
Indica II  465 98.10% 0.60% 0.22% 1.08% NA
Indica III  913 93.60% 5.10% 0.11% 1.10% NA
Indica Intermediate  786 96.30% 2.20% 0.13% 1.40% NA
Temperate Japonica  767 49.80% 36.10% 8.47% 5.61% NA
Tropical Japonica  504 22.00% 1.80% 4.17% 72.02% NA
Japonica Intermediate  241 36.90% 16.20% 7.47% 39.42% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 83.30% 2.20% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103243562 T -> DEL N N silent_mutation Average:58.557; most accessible tissue: Callus, score: 79.26 N N N N
vg0103243562 T -> C LOC_Os01g06836.1 downstream_gene_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:58.557; most accessible tissue: Callus, score: 79.26 N N N N
vg0103243562 T -> C LOC_Os01g06852.1 downstream_gene_variant ; 3437.0bp to feature; MODIFIER silent_mutation Average:58.557; most accessible tissue: Callus, score: 79.26 N N N N
vg0103243562 T -> C LOC_Os01g06836-LOC_Os01g06852 intergenic_region ; MODIFIER silent_mutation Average:58.557; most accessible tissue: Callus, score: 79.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103243562 NA 4.04E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 5.00E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 4.36E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 3.81E-06 NA mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 8.19E-06 1.08E-08 mr1289 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 1.73E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 2.99E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 3.58E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 4.82E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 6.85E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103243562 NA 4.74E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251