Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103221429:

Variant ID: vg0103221429 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3221429
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAACTGGGCACCTATCAAAAGACTCGAGACTGTTCTTACACGGCCAAGGTGTGGCAACTGGACATGCCTAAGGGCAAGGGCAATAGAAAAGACGACT[G/A]
CTTACTCTTAATCTTTATACACGCCATTTAGAGGCAACTTAATAGATAATAAATATAATAGTTGTCTCTTCATATTTACTGCAACACTCATATTAATCAT

Reverse complement sequence

ATGATTAATATGAGTGTTGCAGTAAATATGAAGAGACAACTATTATATTTATTATCTATTAAGTTGCCTCTAAATGGCGTGTATAAAGATTAAGAGTAAG[C/T]
AGTCGTCTTTTCTATTGCCCTTGCCCTTAGGCATGTCCAGTTGCCACACCTTGGCCGTGTAAGAACAGTCTCGAGTCTTTTGATAGGTGCCCAGTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 14.80% 0.19% 24.99% NA
All Indica  2759 90.90% 3.40% 0.00% 5.73% NA
All Japonica  1512 17.00% 20.60% 0.53% 61.84% NA
Aus  269 6.70% 84.80% 0.00% 8.55% NA
Indica I  595 98.20% 0.30% 0.00% 1.51% NA
Indica II  465 92.50% 4.70% 0.00% 2.80% NA
Indica III  913 84.30% 4.80% 0.00% 10.84% NA
Indica Intermediate  786 92.00% 3.30% 0.00% 4.71% NA
Temperate Japonica  767 18.10% 31.30% 1.04% 49.54% NA
Tropical Japonica  504 17.70% 3.80% 0.00% 78.57% NA
Japonica Intermediate  241 12.00% 22.00% 0.00% 65.98% NA
VI/Aromatic  96 4.20% 45.80% 1.04% 48.96% NA
Intermediate  90 56.70% 23.30% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103221429 G -> A LOC_Os01g06780.1 upstream_gene_variant ; 3150.0bp to feature; MODIFIER silent_mutation Average:48.654; most accessible tissue: Callus, score: 74.013 N N N N
vg0103221429 G -> A LOC_Os01g06790.1 upstream_gene_variant ; 874.0bp to feature; MODIFIER silent_mutation Average:48.654; most accessible tissue: Callus, score: 74.013 N N N N
vg0103221429 G -> A LOC_Os01g06780-LOC_Os01g06790 intergenic_region ; MODIFIER silent_mutation Average:48.654; most accessible tissue: Callus, score: 74.013 N N N N
vg0103221429 G -> DEL N N silent_mutation Average:48.654; most accessible tissue: Callus, score: 74.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103221429 NA 2.75E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 2.91E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 7.61E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 7.28E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 2.10E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 7.61E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 3.24E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 4.82E-06 NA mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 8.15E-07 1.28E-06 mr1359 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 1.80E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 1.19E-12 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103221429 NA 5.57E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251