\
| Variant ID: vg0103191059 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3191059 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATCGGTTTTAGAGTGGCCGTTGTTTTGGAGAGCGAAACGCTAGAACTGGAACATTTCTCGTTCCACCAGTAATACCGTAACTTAGTATTGCGCACATGCG[G/C]
TGTGTATGAGCTTGTATGAATCTACTCTTTAACGAACAATGCAATGTAATTCGACTTTAATTACTGTCTAAATTGTAACTTAAGGTGGCAGAATCACCTG
CAGGTGATTCTGCCACCTTAAGTTACAATTTAGACAGTAATTAAAGTCGAATTACATTGCATTGTTCGTTAAAGAGTAGATTCATACAAGCTCATACACA[C/G]
CGCATGTGCGCAATACTAAGTTACGGTATTACTGGTGGAACGAGAAATGTTCCAGTTCTAGCGTTTCGCTCTCCAAAACAACGGCCACTCTAAAACCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 25.90% | 2.05% | 20.57% | NA |
| All Indica | 2759 | 77.70% | 6.20% | 2.61% | 13.45% | NA |
| All Japonica | 1512 | 14.40% | 46.40% | 1.32% | 37.83% | NA |
| Aus | 269 | 8.20% | 87.00% | 0.37% | 4.46% | NA |
| Indica I | 595 | 84.40% | 1.70% | 3.87% | 10.08% | NA |
| Indica II | 465 | 77.00% | 7.10% | 2.80% | 13.12% | NA |
| Indica III | 913 | 74.70% | 9.60% | 1.31% | 14.35% | NA |
| Indica Intermediate | 786 | 76.70% | 5.10% | 3.05% | 15.14% | NA |
| Temperate Japonica | 767 | 15.00% | 75.20% | 0.52% | 9.26% | NA |
| Tropical Japonica | 504 | 15.70% | 5.20% | 2.58% | 76.59% | NA |
| Japonica Intermediate | 241 | 10.00% | 41.10% | 1.24% | 47.72% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 34.40% | 4.44% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103191059 | G -> DEL | N | N | silent_mutation | Average:25.217; most accessible tissue: Callus, score: 90.248 | N | N | N | N |
| vg0103191059 | G -> C | LOC_Os01g06740.1 | upstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:25.217; most accessible tissue: Callus, score: 90.248 | N | N | N | N |
| vg0103191059 | G -> C | LOC_Os01g06740-LOC_Os01g06750 | intergenic_region ; MODIFIER | silent_mutation | Average:25.217; most accessible tissue: Callus, score: 90.248 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103191059 | NA | 1.05E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | 6.44E-06 | 6.44E-06 | mr1512 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | NA | 6.36E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | NA | 1.05E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | NA | 4.06E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | 1.65E-06 | NA | mr1973 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | NA | 5.73E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | NA | 2.83E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103191059 | NA | 6.33E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |