\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103191059:

Variant ID: vg0103191059 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3191059
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGGTTTTAGAGTGGCCGTTGTTTTGGAGAGCGAAACGCTAGAACTGGAACATTTCTCGTTCCACCAGTAATACCGTAACTTAGTATTGCGCACATGCG[G/C]
TGTGTATGAGCTTGTATGAATCTACTCTTTAACGAACAATGCAATGTAATTCGACTTTAATTACTGTCTAAATTGTAACTTAAGGTGGCAGAATCACCTG

Reverse complement sequence

CAGGTGATTCTGCCACCTTAAGTTACAATTTAGACAGTAATTAAAGTCGAATTACATTGCATTGTTCGTTAAAGAGTAGATTCATACAAGCTCATACACA[C/G]
CGCATGTGCGCAATACTAAGTTACGGTATTACTGGTGGAACGAGAAATGTTCCAGTTCTAGCGTTTCGCTCTCCAAAACAACGGCCACTCTAAAACCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 25.90% 2.05% 20.57% NA
All Indica  2759 77.70% 6.20% 2.61% 13.45% NA
All Japonica  1512 14.40% 46.40% 1.32% 37.83% NA
Aus  269 8.20% 87.00% 0.37% 4.46% NA
Indica I  595 84.40% 1.70% 3.87% 10.08% NA
Indica II  465 77.00% 7.10% 2.80% 13.12% NA
Indica III  913 74.70% 9.60% 1.31% 14.35% NA
Indica Intermediate  786 76.70% 5.10% 3.05% 15.14% NA
Temperate Japonica  767 15.00% 75.20% 0.52% 9.26% NA
Tropical Japonica  504 15.70% 5.20% 2.58% 76.59% NA
Japonica Intermediate  241 10.00% 41.10% 1.24% 47.72% NA
VI/Aromatic  96 10.40% 88.50% 0.00% 1.04% NA
Intermediate  90 43.30% 34.40% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103191059 G -> DEL N N silent_mutation Average:25.217; most accessible tissue: Callus, score: 90.248 N N N N
vg0103191059 G -> C LOC_Os01g06740.1 upstream_gene_variant ; 729.0bp to feature; MODIFIER silent_mutation Average:25.217; most accessible tissue: Callus, score: 90.248 N N N N
vg0103191059 G -> C LOC_Os01g06740-LOC_Os01g06750 intergenic_region ; MODIFIER silent_mutation Average:25.217; most accessible tissue: Callus, score: 90.248 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103191059 NA 1.05E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 6.44E-06 6.44E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 NA 6.36E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 NA 1.05E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 NA 4.06E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 1.65E-06 NA mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 NA 5.73E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 NA 2.83E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103191059 NA 6.33E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251