Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103185888:

Variant ID: vg0103185888 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3185888
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTGGAAAATCTTGATTGCTTTGTCCCCATCTCTCCAGCTTCAAGACCGATGATTAATCGGGTGCGGGAACACATGCTGGATATGCAAAGCTAGATGAT[G/C]
TCACCTGAAAATGTACTGCAGAAAAGGAAAAACTACTCACGCAACAAATCGACAGGACGATATGTGCAATTTGCTCTCACCTGTGCTGTGCAACTGCACA

Reverse complement sequence

TGTGCAGTTGCACAGCACAGGTGAGAGCAAATTGCACATATCGTCCTGTCGATTTGTTGCGTGAGTAGTTTTTCCTTTTCTGCAGTACATTTTCAGGTGA[C/G]
ATCATCTAGCTTTGCATATCCAGCATGTGTTCCCGCACCCGATTAATCATCGGTCTTGAAGCTGGAGAGATGGGGACAAAGCAATCAAGATTTTCCACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	39.30%	0.44%	0.15%	NA
All Indica	2759	90.10%	9.20%	0.65%	0.11%	NA
All Japonica	1512	15.60%	84.10%	0.13%	0.13%	NA
Aus	269	10.00%	90.00%	0.00%	0.00%	NA
Indica I	595	97.10%	2.00%	0.84%	0.00%	NA
Indica II	465	91.20%	7.10%	1.29%	0.43%	NA
Indica III	913	84.60%	15.30%	0.00%	0.11%	NA
Indica Intermediate	786	90.50%	8.70%	0.89%	0.00%	NA
Temperate Japonica	767	16.70%	83.10%	0.26%	0.00%	NA
Tropical Japonica	504	16.10%	83.70%	0.00%	0.20%	NA
Japonica Intermediate	241	11.20%	88.40%	0.00%	0.41%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	46.70%	50.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103185888	G -> DEL	N	N	silent_mutation	Average:67.227; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0103185888	G -> C	LOC_Os01g06730.1	downstream_gene_variant ; 542.0bp to feature; MODIFIER	silent_mutation	Average:67.227; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0103185888	G -> C	LOC_Os01g06740.1	downstream_gene_variant ; 2869.0bp to feature; MODIFIER	silent_mutation	Average:67.227; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0103185888	G -> C	LOC_Os01g06730-LOC_Os01g06740	intergenic_region ; MODIFIER	silent_mutation	Average:67.227; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103185888	NA	1.02E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	2.47E-17	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	2.09E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	3.07E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	6.26E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	5.90E-08	5.90E-08	mr1967	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	2.84E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	2.44E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	3.08E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185888	NA	1.46E-12	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251