\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103174854:

Variant ID: vg0103174854 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3174854
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCACCCGTTCATTGCATATCAACTAGATGGTTAAGAACAATTTTAAAAAAAAATTGACAAGATAGATCAATATGTAATATATCACTCCACAAACATG[T/C]
AAGTTTAAATTCAACTTCTACAAGTTGTAACAAAAATAACAAATTTAATTGTAAATATACATATAGTAATTTAAGTTAAGTTTTATTTGCTATTTAATTG

Reverse complement sequence

CAATTAAATAGCAAATAAAACTTAACTTAAATTACTATATGTATATTTACAATTAAATTTGTTATTTTTGTTACAACTTGTAGAAGTTGAATTTAAACTT[A/G]
CATGTTTGTGGAGTGATATATTACATATTGATCTATCTTGTCAATTTTTTTTTAAAATTGTTCTTAACCATCTAGTTGATATGCAATGAACGGGTGGACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.20% 0.20% 0.19% 71.43% NA
All Indica  2759 8.20% 0.10% 0.25% 91.41% NA
All Japonica  1512 48.50% 0.10% 0.13% 51.26% NA
Aus  269 92.20% 0.00% 0.00% 7.81% NA
Indica I  595 5.50% 0.00% 0.00% 94.45% NA
Indica II  465 9.70% 0.00% 0.65% 89.68% NA
Indica III  913 9.70% 0.00% 0.11% 90.14% NA
Indica Intermediate  786 7.60% 0.40% 0.38% 91.60% NA
Temperate Japonica  767 76.50% 0.00% 0.13% 23.34% NA
Tropical Japonica  504 6.20% 0.40% 0.20% 93.25% NA
Japonica Intermediate  241 47.70% 0.00% 0.00% 52.28% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 35.60% 3.30% 0.00% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103174854 T -> DEL N N silent_mutation Average:8.764; most accessible tissue: Callus, score: 22.2 N N N N
vg0103174854 T -> C LOC_Os01g06710.1 upstream_gene_variant ; 3441.0bp to feature; MODIFIER silent_mutation Average:8.764; most accessible tissue: Callus, score: 22.2 N N N N
vg0103174854 T -> C LOC_Os01g06720.1 upstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:8.764; most accessible tissue: Callus, score: 22.2 N N N N
vg0103174854 T -> C LOC_Os01g06710-LOC_Os01g06720 intergenic_region ; MODIFIER silent_mutation Average:8.764; most accessible tissue: Callus, score: 22.2 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103174854 NA 1.57E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 3.44E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 7.17E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 4.51E-06 1.13E-15 mr1540 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 7.44E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 6.46E-06 4.18E-17 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 2.10E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 7.47E-12 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 1.91E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 8.59E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 7.06E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 6.31E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103174854 NA 8.53E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251