\
| Variant ID: vg0103158278 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3158278 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 254. )
GCTCGCCAGATGAACGAGTTGATGGAGAAGACGTCCCGTTACCTTGCTGAGTTCGGGACGGGTGGTCGCTATCTCCAACTTAACTCTGTGAGTTCGGCGA[C/G]
TGACGAATTGCCGACGCTGGAGCTTCCAAAGTCCACGCCCACTGAACGCCGCAACGCCCGCATGGTGGAGGAGGATCTATTTAGCATCCAAGATTGTTTG
CAAACAATCTTGGATGCTAAATAGATCCTCCTCCACCATGCGGGCGTTGCGGCGTTCAGTGGGCGTGGACTTTGGAAGCTCCAGCGTCGGCAATTCGTCA[G/C]
TCGCCGAACTCACAGAGTTAAGTTGGAGATAGCGACCACCCGTCCCGAACTCAGCAAGGTAACGGGACGTCTTCTCCATCAACTCGTTCATCTGGCGAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 0.30% | 2.01% | 4.63% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.50% | 0.90% | 6.22% | 14.42% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.40% | 0.10% | 2.74% | 11.73% | NA |
| Tropical Japonica | 504 | 70.00% | 0.60% | 5.36% | 24.01% | NA |
| Japonica Intermediate | 241 | 74.30% | 3.70% | 19.09% | 2.90% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103158278 | C -> G | LOC_Os01g06690.1 | missense_variant ; p.Thr285Ser; MODERATE | nonsynonymous_codon ; T285S | Average:19.294; most accessible tissue: Callus, score: 36.976 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0103158278 | C -> DEL | LOC_Os01g06690.1 | N | frameshift_variant | Average:19.294; most accessible tissue: Callus, score: 36.976 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103158278 | NA | 1.42E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 7.68E-08 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 4.66E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | 7.04E-06 | 5.07E-09 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 9.97E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 5.77E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 8.52E-09 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 8.09E-08 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 4.63E-07 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | 3.47E-07 | 4.77E-07 | mr1682 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 3.71E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 1.17E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 8.85E-07 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158278 | NA | 5.85E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |