\
| Variant ID: vg0103143509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3143509 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAACATACAAGAACCTGAAAGCATCACTACAGCTTCACTATAGTTTTAGAGCAATTTTACGGTACTTGAGGAGATACCATGAGGTACCATTTTTTCTATT[G/A]
TAAATTTGGTACCTCTTGGTACCTAGGTACTATGAGGTACTAAAATTTTGGTACCTCATGATACCTCCTTAAGAACCGTAGAATTGCTCATAGTTTTAAC
GTTAAAACTATGAGCAATTCTACGGTTCTTAAGGAGGTATCATGAGGTACCAAAATTTTAGTACCTCATAGTACCTAGGTACCAAGAGGTACCAAATTTA[C/T]
AATAGAAAAAATGGTACCTCATGGTATCTCCTCAAGTACCGTAAAATTGCTCTAAAACTATAGTGAAGCTGTAGTGATGCTTTCAGGTTCTTGTATGTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.20% | 0.40% | 0.68% | 71.67% | NA |
| All Indica | 2759 | 7.30% | 0.10% | 0.87% | 91.66% | NA |
| All Japonica | 1512 | 48.00% | 0.00% | 0.33% | 51.65% | NA |
| Aus | 269 | 86.60% | 6.30% | 0.00% | 7.06% | NA |
| Indica I | 595 | 4.40% | 0.20% | 0.84% | 94.62% | NA |
| Indica II | 465 | 8.40% | 0.00% | 0.86% | 90.75% | NA |
| Indica III | 913 | 9.20% | 0.10% | 0.77% | 89.92% | NA |
| Indica Intermediate | 786 | 6.70% | 0.30% | 1.02% | 91.98% | NA |
| Temperate Japonica | 767 | 76.40% | 0.00% | 0.13% | 23.47% | NA |
| Tropical Japonica | 504 | 5.80% | 0.00% | 0.40% | 93.85% | NA |
| Japonica Intermediate | 241 | 46.10% | 0.00% | 0.83% | 53.11% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 36.70% | 0.00% | 3.33% | 60.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103143509 | G -> A | LOC_Os01g06660.1 | upstream_gene_variant ; 3292.0bp to feature; MODIFIER | silent_mutation | Average:12.847; most accessible tissue: Callus, score: 74.613 | N | N | N | N |
| vg0103143509 | G -> A | LOC_Os01g06670.1 | downstream_gene_variant ; 92.0bp to feature; MODIFIER | silent_mutation | Average:12.847; most accessible tissue: Callus, score: 74.613 | N | N | N | N |
| vg0103143509 | G -> A | LOC_Os01g06680.1 | downstream_gene_variant ; 3870.0bp to feature; MODIFIER | silent_mutation | Average:12.847; most accessible tissue: Callus, score: 74.613 | N | N | N | N |
| vg0103143509 | G -> A | LOC_Os01g06660-LOC_Os01g06670 | intergenic_region ; MODIFIER | silent_mutation | Average:12.847; most accessible tissue: Callus, score: 74.613 | N | N | N | N |
| vg0103143509 | G -> DEL | N | N | silent_mutation | Average:12.847; most accessible tissue: Callus, score: 74.613 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103143509 | 1.65E-06 | NA | mr1030 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 6.62E-06 | NA | mr1045 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 8.68E-06 | NA | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 1.69E-06 | NA | mr1054 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 7.64E-06 | NA | mr1060 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 8.22E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 3.71E-06 | NA | mr1157 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 1.80E-06 | 7.83E-19 | mr1164 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 4.61E-07 | 1.04E-08 | mr1215 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 9.77E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 7.63E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 2.56E-07 | NA | mr1230 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 1.99E-09 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 3.58E-07 | NA | mr1287 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 8.23E-06 | NA | mr1290 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 2.06E-07 | NA | mr1314 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 7.09E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 3.18E-06 | NA | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 1.31E-07 | NA | mr1327 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 6.15E-06 | 6.15E-06 | mr1327 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 5.84E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 2.02E-06 | 1.03E-12 | mr1352 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 3.16E-06 | NA | mr1359 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 1.05E-06 | NA | mr1372 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 8.51E-06 | NA | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 4.97E-06 | NA | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 5.84E-06 | 3.54E-08 | mr1450 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 4.39E-07 | NA | mr1472 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 6.62E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 4.53E-07 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 9.45E-06 | 1.28E-10 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 1.36E-16 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 7.25E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 1.51E-06 | NA | mr1614 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 2.77E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 7.61E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 3.03E-06 | NA | mr1809 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 6.39E-06 | 2.30E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 5.11E-06 | NA | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 1.19E-08 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 9.72E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | 2.16E-07 | 2.16E-07 | mr1967 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103143509 | NA | 2.56E-22 | mr1401_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |