Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103132262:

Variant ID: vg0103132262 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3132262
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.30, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGTGACAAATATGAATCATTGCAATCCTTAAAATAAATAGATGACTTATTTACCTTAACTTAGGTTGCAACTCAGAACAGCCCGAGAATGCAACCGAC[A/G]
ACACGGACGAGGCAAACACCAATAACAGCAGCAACAGCGGAACCAACGGACTAACACCCAACACCACAGGCGACGGCTGGGAACCAGGACGAAACCCTAC

Reverse complement sequence

GTAGGGTTTCGTCCTGGTTCCCAGCCGTCGCCTGTGGTGTTGGGTGTTAGTCCGTTGGTTCCGCTGTTGCTGCTGTTATTGGTGTTTGCCTCGTCCGTGT[T/C]
GTCGGTTGCATTCTCGGGCTGTTCTGAGTTGCAACCTAAGTTAAGGTAAATAAGTCATCTATTTATTTTAAGGATTGCAATGATTCATATTTGTCACCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	25.60%	0.72%	1.12%	NA
All Indica	2759	91.60%	7.30%	0.65%	0.40%	NA
All Japonica	1512	53.00%	45.00%	0.20%	1.79%	NA
Aus	269	13.00%	79.20%	2.97%	4.83%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	92.90%	6.00%	0.65%	0.43%	NA
Indica III	913	86.40%	11.70%	0.99%	0.88%	NA
Indica Intermediate	786	92.00%	7.10%	0.76%	0.13%	NA
Temperate Japonica	767	78.40%	20.30%	0.26%	1.04%	NA
Tropical Japonica	504	18.70%	80.40%	0.20%	0.79%	NA
Japonica Intermediate	241	44.00%	49.80%	0.00%	6.22%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	54.40%	37.80%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103132262	A -> G	LOC_Os01g06650.1	upstream_gene_variant ; 1955.0bp to feature; MODIFIER	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0103132262	A -> G	LOC_Os01g06640.1	downstream_gene_variant ; 1540.0bp to feature; MODIFIER	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0103132262	A -> G	LOC_Os01g06660.1	downstream_gene_variant ; 3842.0bp to feature; MODIFIER	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0103132262	A -> G	LOC_Os01g06640.3	downstream_gene_variant ; 1540.0bp to feature; MODIFIER	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0103132262	A -> G	LOC_Os01g06640.2	downstream_gene_variant ; 1540.0bp to feature; MODIFIER	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0103132262	A -> G	LOC_Os01g06640-LOC_Os01g06650	intergenic_region ; MODIFIER	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0103132262	A -> DEL	N	N	silent_mutation	Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103132262	NA	4.67E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.46E-06	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	3.60E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	2.82E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.37E-06	mr1185_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	3.27E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.04E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	3.82E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	7.66E-08	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	4.35E-08	mr1291_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	5.58E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.02E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.85E-11	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	3.33E-11	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	6.02E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	4.88E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	2.17E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.53E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	6.60E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	5.13E-15	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	5.34E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.69E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262	NA	1.78E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251