\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103132262:

Variant ID: vg0103132262 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3132262
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.30, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGTGACAAATATGAATCATTGCAATCCTTAAAATAAATAGATGACTTATTTACCTTAACTTAGGTTGCAACTCAGAACAGCCCGAGAATGCAACCGAC[A/G]
ACACGGACGAGGCAAACACCAATAACAGCAGCAACAGCGGAACCAACGGACTAACACCCAACACCACAGGCGACGGCTGGGAACCAGGACGAAACCCTAC

Reverse complement sequence

GTAGGGTTTCGTCCTGGTTCCCAGCCGTCGCCTGTGGTGTTGGGTGTTAGTCCGTTGGTTCCGCTGTTGCTGCTGTTATTGGTGTTTGCCTCGTCCGTGT[T/C]
GTCGGTTGCATTCTCGGGCTGTTCTGAGTTGCAACCTAAGTTAAGGTAAATAAGTCATCTATTTATTTTAAGGATTGCAATGATTCATATTTGTCACCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 25.60% 0.72% 1.12% NA
All Indica  2759 91.60% 7.30% 0.65% 0.40% NA
All Japonica  1512 53.00% 45.00% 0.20% 1.79% NA
Aus  269 13.00% 79.20% 2.97% 4.83% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 92.90% 6.00% 0.65% 0.43% NA
Indica III  913 86.40% 11.70% 0.99% 0.88% NA
Indica Intermediate  786 92.00% 7.10% 0.76% 0.13% NA
Temperate Japonica  767 78.40% 20.30% 0.26% 1.04% NA
Tropical Japonica  504 18.70% 80.40% 0.20% 0.79% NA
Japonica Intermediate  241 44.00% 49.80% 0.00% 6.22% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 54.40% 37.80% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103132262 A -> G LOC_Os01g06650.1 upstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0103132262 A -> G LOC_Os01g06640.1 downstream_gene_variant ; 1540.0bp to feature; MODIFIER silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0103132262 A -> G LOC_Os01g06660.1 downstream_gene_variant ; 3842.0bp to feature; MODIFIER silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0103132262 A -> G LOC_Os01g06640.3 downstream_gene_variant ; 1540.0bp to feature; MODIFIER silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0103132262 A -> G LOC_Os01g06640.2 downstream_gene_variant ; 1540.0bp to feature; MODIFIER silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0103132262 A -> G LOC_Os01g06640-LOC_Os01g06650 intergenic_region ; MODIFIER silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0103132262 A -> DEL N N silent_mutation Average:50.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103132262 NA 4.67E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.46E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 3.60E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 2.82E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.37E-06 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 3.27E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.04E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 3.82E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 7.66E-08 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 4.35E-08 mr1291_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 5.58E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.02E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.85E-11 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 3.33E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 6.02E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 4.88E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 2.17E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.53E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 6.60E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 5.13E-15 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 5.34E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.69E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132262 NA 1.78E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251