\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103126664:

Variant ID: vg0103126664 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3126664
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.22, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGCTATGTTCGGTTAATCCCCAAGAGGGAGCGATTGAAGAGGATTTATTCCACACCTACTCTGGTGTAGAATTATTTCCCCTCAAACACCTCCAATCT[T/C]
TTTCAACCCCTCTAAACTGAACAAGGCCTACAACAGTGCAGCTTGCGGATGTGCAACAAGCAGGGACAAAATAATTGGGAGAATCATCCGCATGCAACAC

Reverse complement sequence

GTGTTGCATGCGGATGATTCTCCCAATTATTTTGTCCCTGCTTGTTGCACATCCGCAAGCTGCACTGTTGTAGGCCTTGTTCAGTTTAGAGGGGTTGAAA[A/G]
AGATTGGAGGTGTTTGAGGGGAAATAATTCTACACCAGAGTAGGTGTGGAATAAATCCTCTTCAATCGCTCCCTCTTGGGGATTAACCGAACATAGCCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.40% 0.21% 0.00% NA
All Indica  2759 96.40% 3.40% 0.14% 0.00% NA
All Japonica  1512 26.30% 73.30% 0.33% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 94.20% 5.70% 0.11% 0.00% NA
Indica Intermediate  786 97.30% 2.50% 0.13% 0.00% NA
Temperate Japonica  767 32.50% 67.40% 0.13% 0.00% NA
Tropical Japonica  504 18.10% 81.70% 0.20% 0.00% NA
Japonica Intermediate  241 24.10% 74.70% 1.24% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103126664 T -> C LOC_Os01g06630.1 upstream_gene_variant ; 1339.0bp to feature; MODIFIER silent_mutation Average:58.237; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0103126664 T -> C LOC_Os01g06640.1 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:58.237; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0103126664 T -> C LOC_Os01g06640.3 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:58.237; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0103126664 T -> C LOC_Os01g06640.2 upstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:58.237; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0103126664 T -> C LOC_Os01g06620.1 downstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:58.237; most accessible tissue: Minghui63 root, score: 85.569 N N N N
vg0103126664 T -> C LOC_Os01g06630-LOC_Os01g06640 intergenic_region ; MODIFIER silent_mutation Average:58.237; most accessible tissue: Minghui63 root, score: 85.569 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103126664 T C 0.1 0.06 0.04 0.01 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103126664 9.79E-06 9.79E-06 mr1054 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.59E-14 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 4.40E-06 4.52E-07 mr1171 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 5.29E-15 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 4.75E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 4.51E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 5.01E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 5.22E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.05E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.01E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 9.45E-06 9.46E-06 mr1327 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 4.74E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 2.49E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 5.07E-06 8.28E-07 mr1352 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 3.38E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 2.87E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 3.18E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 4.15E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 3.34E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 9.80E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.52E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 4.00E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 9.30E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.38E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.77E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 2.42E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 4.65E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 1.22E-06 NA mr1712 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.09E-07 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.12E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.14E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.12E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103126664 NA 1.68E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251