Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103093065:

Variant ID: vg0103093065 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3093065
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCATCTAATCTCATATGATATTTTTAGAGATAATACATTAAGTATTAATGTCCTAGAGCACTTGCTCTCACAAACACGGACTTTCAGATCACGTGAAAA[A/G]
AGCCTTTTTGTTTGGGATTGTTTCGTTCATAAAATACCCTTTTTTGTTTTGGTTGCAGAGAAAATACTGGTGGCCTACAGTGATCCATGTATGCAGCATG

Reverse complement sequence

CATGCTGCATACATGGATCACTGTAGGCCACCAGTATTTTCTCTGCAACCAAAACAAAAAAGGGTATTTTATGAACGAAACAATCCCAAACAAAAAGGCT[T/C]
TTTTCACGTGATCTGAAAGTCCGTGTTTGTGAGAGCAAGTGCTCTAGGACATTAATACTTAATGTATTATCTCTAAAAATATCATATGAGATTAGATGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	10.70%	1.10%	0.00%	NA
All Indica	2759	98.10%	1.90%	0.00%	0.00%	NA
All Japonica	1512	74.30%	22.40%	3.31%	0.00%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	96.20%	3.80%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	59.50%	34.60%	6.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	70.50%	27.80%	1.66%	0.00%	NA
VI/Aromatic	96	16.70%	81.20%	2.08%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103093065	A -> G	LOC_Os01g06550.1	upstream_gene_variant ; 2178.0bp to feature; MODIFIER	silent_mutation	Average:95.838; most accessible tissue: Callus, score: 99.854	N	N	N	N
vg0103093065	A -> G	LOC_Os01g06560.1	upstream_gene_variant ; 200.0bp to feature; MODIFIER	silent_mutation	Average:95.838; most accessible tissue: Callus, score: 99.854	N	N	N	N
vg0103093065	A -> G	LOC_Os01g06570.1	upstream_gene_variant ; 2145.0bp to feature; MODIFIER	silent_mutation	Average:95.838; most accessible tissue: Callus, score: 99.854	N	N	N	N
vg0103093065	A -> G	LOC_Os01g06560.2	upstream_gene_variant ; 200.0bp to feature; MODIFIER	silent_mutation	Average:95.838; most accessible tissue: Callus, score: 99.854	N	N	N	N
vg0103093065	A -> G	LOC_Os01g06580.1	downstream_gene_variant ; 4281.0bp to feature; MODIFIER	silent_mutation	Average:95.838; most accessible tissue: Callus, score: 99.854	N	N	N	N
vg0103093065	A -> G	LOC_Os01g06560-LOC_Os01g06570	intergenic_region ; MODIFIER	silent_mutation	Average:95.838; most accessible tissue: Callus, score: 99.854	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0103093065	A	G	0.0	0.0	0.0	0.01	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103093065	NA	2.33E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103093065	NA	2.32E-06	mr1092	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	9.67E-07	3.42E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	2.96E-09	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	3.94E-06	3.49E-11	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	4.26E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	1.04E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	2.73E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	3.08E-06	NA	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	5.61E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	2.78E-06	1.01E-13	mr1567_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	3.50E-10	mr1567_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	8.57E-06	8.57E-06	mr1806_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	3.12E-09	8.43E-18	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	1.16E-10	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	1.18E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	3.06E-08	1.67E-21	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103093065	NA	2.48E-10	mr1902_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251