\
| Variant ID: vg0103053858 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3053858 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAAGGGTAGAAAGAAGATAAAGAAAATGAGTCAACTCCTATGTGGCATGTCACATGAGCACCATGCAGAATTCTGAAGTGGTTGTAGCAATTTAGGAC[C/T]
AAAATAACATATTTTGATAAGTTTGGTGACCTGGACGACACGGACGAACAAATTTAGAGACCAACAATACACTTTACTCTAAATTTTACTATGTAGTAAA
TTTACTACATAGTAAAATTTAGAGTAAAGTGTATTGTTGGTCTCTAAATTTGTTCGTCCGTGTCGTCCAGGTCACCAAACTTATCAAAATATGTTATTTT[G/A]
GTCCTAAATTGCTACAACCACTTCAGAATTCTGCATGGTGCTCATGTGACATGCCACATAGGAGTTGACTCATTTTCTTTATCTTCTTTCTACCCTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 0.80% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 96.50% | 1.90% | 1.59% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 2.30% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 7.30% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103053858 | C -> T | LOC_Os01g06490.1 | upstream_gene_variant ; 607.0bp to feature; MODIFIER | silent_mutation | Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
| vg0103053858 | C -> T | LOC_Os01g06490.2 | upstream_gene_variant ; 607.0bp to feature; MODIFIER | silent_mutation | Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
| vg0103053858 | C -> T | LOC_Os01g06470.1 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
| vg0103053858 | C -> T | LOC_Os01g06500.1 | downstream_gene_variant ; 4685.0bp to feature; MODIFIER | silent_mutation | Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
| vg0103053858 | C -> T | LOC_Os01g06500.2 | downstream_gene_variant ; 4685.0bp to feature; MODIFIER | silent_mutation | Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
| vg0103053858 | C -> T | LOC_Os01g06470-LOC_Os01g06490 | intergenic_region ; MODIFIER | silent_mutation | Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103053858 | 5.95E-06 | 5.95E-06 | mr1389 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | NA | 6.25E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | 4.50E-08 | 4.50E-08 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | 5.43E-10 | 2.87E-10 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | 9.58E-06 | 9.58E-06 | mr1141_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | NA | 4.92E-07 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | NA | 3.73E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | NA | 1.12E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103053858 | 4.14E-06 | 1.80E-09 | mr1842_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |