\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103053858:

Variant ID: vg0103053858 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3053858
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGGGTAGAAAGAAGATAAAGAAAATGAGTCAACTCCTATGTGGCATGTCACATGAGCACCATGCAGAATTCTGAAGTGGTTGTAGCAATTTAGGAC[C/T]
AAAATAACATATTTTGATAAGTTTGGTGACCTGGACGACACGGACGAACAAATTTAGAGACCAACAATACACTTTACTCTAAATTTTACTATGTAGTAAA

Reverse complement sequence

TTTACTACATAGTAAAATTTAGAGTAAAGTGTATTGTTGGTCTCTAAATTTGTTCGTCCGTGTCGTCCAGGTCACCAAACTTATCAAAATATGTTATTTT[G/A]
GTCCTAAATTGCTACAACCACTTCAGAATTCTGCATGGTGCTCATGTGACATGCCACATAGGAGTTGACTCATTTTCTTTATCTTCTTTCTACCCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 0.80% 0.59% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 96.50% 1.90% 1.59% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 94.80% 2.30% 2.87% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 4.60% 0.83% 0.00% NA
VI/Aromatic  96 89.60% 7.30% 3.12% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103053858 C -> T LOC_Os01g06490.1 upstream_gene_variant ; 607.0bp to feature; MODIFIER silent_mutation Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg0103053858 C -> T LOC_Os01g06490.2 upstream_gene_variant ; 607.0bp to feature; MODIFIER silent_mutation Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg0103053858 C -> T LOC_Os01g06470.1 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg0103053858 C -> T LOC_Os01g06500.1 downstream_gene_variant ; 4685.0bp to feature; MODIFIER silent_mutation Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg0103053858 C -> T LOC_Os01g06500.2 downstream_gene_variant ; 4685.0bp to feature; MODIFIER silent_mutation Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg0103053858 C -> T LOC_Os01g06470-LOC_Os01g06490 intergenic_region ; MODIFIER silent_mutation Average:56.65; most accessible tissue: Minghui63 flower, score: 74.976 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103053858 5.95E-06 5.95E-06 mr1389 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 NA 6.25E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 4.50E-08 4.50E-08 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 5.43E-10 2.87E-10 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 9.58E-06 9.58E-06 mr1141_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 NA 4.92E-07 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 NA 3.73E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 NA 1.12E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103053858 4.14E-06 1.80E-09 mr1842_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251