\
| Variant ID: vg0103031868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3031868 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTCGGAGTTTGCCCCACCGTGACCCTCGAGGAGGCCCGCTGCGAGATCTCGCGGGGCGCCGCTCGCCACGCGATGGCCGACCACGTCTTCGTTCGCTAC[G/A]
TCGAGCTCCTCGGCATCCAGCACGAGCCGCCGTGCACCAGCAGGGACACCCACCACCGGGAGGCCATCCGCTTCACCGCCATGGCCCTGGAGAAGGTCAG
CTGACCTTCTCCAGGGCCATGGCGGTGAAGCGGATGGCCTCCCGGTGGTGGGTGTCCCTGCTGGTGCACGGCGGCTCGTGCTGGATGCCGAGGAGCTCGA[C/T]
GTAGCGAACGAAGACGTGGTCGGCCATCGCGTGGCGAGCGGCGCCCCGCGAGATCTCGCAGCGGGCCTCCTCGAGGGTCACGGTGGGGCAAACTCCGACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.30% | 25.50% | 0.08% | 0.11% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 28.40% | 71.40% | 0.07% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.20% | 0.43% | 0.22% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.70% | 87.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 38.20% | 61.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 58.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 28.90% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103031868 | G -> A | LOC_Os01g06400.1 | missense_variant ; p.Val97Ile; MODERATE | nonsynonymous_codon ; V97I | Average:73.956; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | unknown | unknown | TOLERATED | 0.34 |
| vg0103031868 | G -> DEL | LOC_Os01g06400.1 | N | frameshift_variant | Average:73.956; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103031868 | 4.03E-06 | NA | mr1064 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 1.77E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 1.52E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 3.16E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 1.95E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 2.69E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 3.12E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 2.50E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 4.36E-18 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 1.27E-08 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 1.71E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 2.05E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103031868 | NA | 3.85E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |