\
| Variant ID: vg0102859069 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2859069 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 92. )
TAACTCGAGGGAAGGAGATTGGGAGTTTACACGAGGGAATTGATAATGAGATTAAGATGGGAATTTGATTTTTAATCTCAATATCTTGTTTGGTAGAGGT[A/G]
ATGGAAATTGATAGGGAGTTTAGTTGGAGATTAAGTCATTAATAAAAACAGATGGCTCAGATTTGCTTAGAAAAAGTAAAGGAGGAATTCCCTCCCAATT
AATTGGGAGGGAATTCCTCCTTTACTTTTTCTAAGCAAATCTGAGCCATCTGTTTTTATTAATGACTTAATCTCCAACTAAACTCCCTATCAATTTCCAT[T/C]
ACCTCTACCAAACAAGATATTGAGATTAAAAATCAAATTCCCATCTTAATCTCATTATCAATTCCCTCGTGTAAACTCCCAATCTCCTTCCCTCGAGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 48.30% | 0.08% | 0.42% | NA |
| All Indica | 2759 | 32.30% | 67.10% | 0.07% | 0.58% | NA |
| All Japonica | 1512 | 76.50% | 23.40% | 0.00% | 0.07% | NA |
| Aus | 269 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 11.10% | 88.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 13.30% | 86.00% | 0.00% | 0.65% | NA |
| Indica III | 913 | 54.20% | 45.00% | 0.22% | 0.55% | NA |
| Indica Intermediate | 786 | 34.10% | 65.00% | 0.00% | 0.89% | NA |
| Temperate Japonica | 767 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.80% | 25.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 69.30% | 30.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 41.10% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102859069 | A -> G | LOC_Os01g05970.1 | upstream_gene_variant ; 935.0bp to feature; MODIFIER | silent_mutation | Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 | N | N | N | N |
| vg0102859069 | A -> G | LOC_Os01g05980.1 | downstream_gene_variant ; 3844.0bp to feature; MODIFIER | silent_mutation | Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 | N | N | N | N |
| vg0102859069 | A -> G | LOC_Os01g06000.1 | downstream_gene_variant ; 3491.0bp to feature; MODIFIER | silent_mutation | Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 | N | N | N | N |
| vg0102859069 | A -> G | LOC_Os01g05970-LOC_Os01g06000 | intergenic_region ; MODIFIER | silent_mutation | Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 | N | N | N | N |
| vg0102859069 | A -> DEL | N | N | silent_mutation | Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102859069 | NA | 6.28E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102859069 | NA | 2.57E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102859069 | NA | 5.46E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102859069 | NA | 1.47E-07 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102859069 | 1.18E-06 | 6.76E-07 | mr1347 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102859069 | NA | 2.37E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |