\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102859069:

Variant ID: vg0102859069 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2859069
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTCGAGGGAAGGAGATTGGGAGTTTACACGAGGGAATTGATAATGAGATTAAGATGGGAATTTGATTTTTAATCTCAATATCTTGTTTGGTAGAGGT[A/G]
ATGGAAATTGATAGGGAGTTTAGTTGGAGATTAAGTCATTAATAAAAACAGATGGCTCAGATTTGCTTAGAAAAAGTAAAGGAGGAATTCCCTCCCAATT

Reverse complement sequence

AATTGGGAGGGAATTCCTCCTTTACTTTTTCTAAGCAAATCTGAGCCATCTGTTTTTATTAATGACTTAATCTCCAACTAAACTCCCTATCAATTTCCAT[T/C]
ACCTCTACCAAACAAGATATTGAGATTAAAAATCAAATTCCCATCTTAATCTCATTATCAATTCCCTCGTGTAAACTCCCAATCTCCTTCCCTCGAGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.30% 0.08% 0.42% NA
All Indica  2759 32.30% 67.10% 0.07% 0.58% NA
All Japonica  1512 76.50% 23.40% 0.00% 0.07% NA
Aus  269 86.20% 13.80% 0.00% 0.00% NA
Indica I  595 11.10% 88.70% 0.00% 0.17% NA
Indica II  465 13.30% 86.00% 0.00% 0.65% NA
Indica III  913 54.20% 45.00% 0.22% 0.55% NA
Indica Intermediate  786 34.10% 65.00% 0.00% 0.89% NA
Temperate Japonica  767 79.90% 20.10% 0.00% 0.00% NA
Tropical Japonica  504 74.80% 25.00% 0.00% 0.20% NA
Japonica Intermediate  241 69.30% 30.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 53.30% 41.10% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102859069 A -> G LOC_Os01g05970.1 upstream_gene_variant ; 935.0bp to feature; MODIFIER silent_mutation Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 N N N N
vg0102859069 A -> G LOC_Os01g05980.1 downstream_gene_variant ; 3844.0bp to feature; MODIFIER silent_mutation Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 N N N N
vg0102859069 A -> G LOC_Os01g06000.1 downstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 N N N N
vg0102859069 A -> G LOC_Os01g05970-LOC_Os01g06000 intergenic_region ; MODIFIER silent_mutation Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 N N N N
vg0102859069 A -> DEL N N silent_mutation Average:40.022; most accessible tissue: Zhenshan97 flower, score: 55.587 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102859069 NA 6.28E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069 NA 2.57E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069 NA 5.46E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069 NA 1.47E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069 1.18E-06 6.76E-07 mr1347 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102859069 NA 2.37E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251