Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0102812041:

Variant ID: vg0102812041 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2812041
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAGCCTCAGGATGAACAGTCTCGAGGGCACAATACCTCCTGAATTCGGCAGCAACATGCCGCGCCTTTACTTCCTCGACATCTGCTCCAACAACCTGAG[T/C]
GGTGCACTCCCGTCTTCCCTGTACAATCTGTCGTCGCTAATGGGGTTTGATGCAGGAAACAACAAGCTGGATGGAAGCATTGCTACTGATATCGATGAAA

Reverse complement sequence

TTTCATCGATATCAGTAGCAATGCTTCCATCCAGCTTGTTGTTTCCTGCATCAAACCCCATTAGCGACGACAGATTGTACAGGGAAGACGGGAGTGCACC[A/G]
CTCAGGTTGTTGGAGCAGATGTCGAGGAAGTAAAGGCGCGGCATGTTGCTGCCGAATTCAGGAGGTATTGTGCCCTCGAGACTGTTCATCCTGAGGCTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	27.40%	0.28%	0.51%	NA
All Indica	2759	57.10%	41.70%	0.43%	0.76%	NA
All Japonica	1512	92.30%	7.70%	0.00%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	76.00%	23.40%	0.50%	0.17%	NA
Indica II	465	30.50%	67.10%	1.08%	1.29%	NA
Indica III	913	61.40%	37.60%	0.00%	0.99%	NA
Indica Intermediate	786	53.40%	45.40%	0.51%	0.64%	NA
Temperate Japonica	767	85.40%	14.60%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	21.10%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102812041	T -> DEL	LOC_Os01g05870.1	N	frameshift_variant	Average:69.833; most accessible tissue: Callus, score: 85.869	N	N	N	N
vg0102812041	T -> C	LOC_Os01g05870.1	synonymous_variant ; p.Ser234Ser; LOW	synonymous_codon	Average:69.833; most accessible tissue: Callus, score: 85.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102812041	NA	1.74E-13	mr1174	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	8.45E-09	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	1.19E-06	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	1.11E-13	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	4.12E-09	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	8.28E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	5.16E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	5.11E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102812041	NA	3.66E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251