\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102809057:

Variant ID: vg0102809057 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2809057
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCGAGTTAAGAAAGGGCCATTGTCTTTCCTTTTTTTTTTTTGAGCTTATGCTAGGAGGCGTATTTGGCCGATGTGCACTGTGCCACTGTCGTGTAATCG[A/G]
AAATAAGGCCCCCTTTGAATTGGAGGAAAAATAAAGGAATTGAAATCCTACACTATTCATGTCGTTGATTCGTCGGAATAAGAAAAGGAAAAACGTAGGA

Reverse complement sequence

TCCTACGTTTTTCCTTTTCTTATTCCGACGAATCAACGACATGAATAGTGTAGGATTTCAATTCCTTTATTTTTCCTCCAATTCAAAGGGGGCCTTATTT[T/C]
CGATTACACGACAGTGGCACAGTGCACATCGGCCAAATACGCCTCCTAGCATAAGCTCAAAAAAAAAAAAGGAAAGACAATGGCCCTTTCTTAACTCGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 13.00% 12.38% 15.53% NA
All Indica  2759 57.40% 12.60% 11.82% 18.12% NA
All Japonica  1512 55.60% 14.90% 15.15% 14.29% NA
Aus  269 97.40% 2.20% 0.00% 0.37% NA
Indica I  595 75.10% 4.50% 9.58% 10.76% NA
Indica II  465 30.80% 17.60% 21.94% 29.68% NA
Indica III  913 62.40% 15.00% 6.79% 15.77% NA
Indica Intermediate  786 54.10% 13.00% 13.36% 19.59% NA
Temperate Japonica  767 25.30% 23.20% 27.38% 24.12% NA
Tropical Japonica  504 96.40% 2.00% 0.79% 0.79% NA
Japonica Intermediate  241 66.80% 15.80% 6.22% 11.20% NA
VI/Aromatic  96 40.60% 29.20% 22.92% 7.29% NA
Intermediate  90 71.10% 8.90% 8.89% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102809057 A -> G LOC_Os01g05850.1 upstream_gene_variant ; 4213.0bp to feature; MODIFIER silent_mutation Average:40.756; most accessible tissue: Callus, score: 70.32 N N N N
vg0102809057 A -> G LOC_Os01g05870.1 upstream_gene_variant ; 1256.0bp to feature; MODIFIER silent_mutation Average:40.756; most accessible tissue: Callus, score: 70.32 N N N N
vg0102809057 A -> G LOC_Os01g05860.1 downstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:40.756; most accessible tissue: Callus, score: 70.32 N N N N
vg0102809057 A -> G LOC_Os01g05860-LOC_Os01g05870 intergenic_region ; MODIFIER silent_mutation Average:40.756; most accessible tissue: Callus, score: 70.32 N N N N
vg0102809057 A -> DEL N N silent_mutation Average:40.756; most accessible tissue: Callus, score: 70.32 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102809057 NA 2.72E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.82E-10 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 3.85E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 3.83E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 8.80E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.68E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 3.13E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 3.66E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 9.00E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 4.30E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 3.13E-06 3.12E-06 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 4.08E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.95E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 5.98E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 8.38E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 6.18E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 5.20E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 3.84E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 5.19E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.29E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 2.31E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 5.86E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.13E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 4.33E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 3.79E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 8.25E-17 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 4.43E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.86E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 1.71E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 9.64E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 2.19E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 2.10E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102809057 NA 2.31E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251