Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102765446:

Variant ID: vg0102765446 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2765446
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TCACATCGGATATTTGGACACTAATTATAAATATTAAACGTAGACTATTAATAAAACACATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTGAG[C/T]
CTAATTAATCCATGATTAGCTTATGTGATGCTACATTAAACAATCTCTAATTATGGATTAATTAGGCTTAAAATATTTGTCTCACGAATTAGCTTTCATT

Reverse complement sequence

AATGAAAGCTAATTCGTGAGACAAATATTTTAAGCCTAATTAATCCATAATTAGAGATTGTTTAATGTAGCATCACATAAGCTAATCATGGATTAATTAG[G/A]
CTCAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGTGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTCCAAATATCCGATGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 24.20% 14.13% 8.99% NA
All Indica  2759 47.00% 29.20% 13.16% 10.62% NA
All Japonica  1512 54.20% 20.00% 18.12% 7.74% NA
Aus  269 87.00% 6.70% 4.83% 1.49% NA
Indica I  595 28.20% 59.20% 6.05% 6.55% NA
Indica II  465 75.50% 7.10% 10.75% 6.67% NA
Indica III  913 41.00% 26.70% 17.52% 14.79% NA
Indica Intermediate  786 51.30% 22.60% 14.89% 11.20% NA
Temperate Japonica  767 88.30% 3.70% 6.13% 1.96% NA
Tropical Japonica  504 6.90% 41.30% 35.12% 16.67% NA
Japonica Intermediate  241 44.40% 27.40% 20.75% 7.47% NA
VI/Aromatic  96 92.70% 3.10% 3.12% 1.04% NA
Intermediate  90 58.90% 13.30% 16.67% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102765446 C -> T LOC_Os01g05790.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:69.872; most accessible tissue: Callus, score: 95.357 N N N N
vg0102765446 C -> T LOC_Os01g05800.1 upstream_gene_variant ; 4694.0bp to feature; MODIFIER silent_mutation Average:69.872; most accessible tissue: Callus, score: 95.357 N N N N
vg0102765446 C -> T LOC_Os01g05800.2 upstream_gene_variant ; 4694.0bp to feature; MODIFIER silent_mutation Average:69.872; most accessible tissue: Callus, score: 95.357 N N N N
vg0102765446 C -> T LOC_Os01g05780.1 downstream_gene_variant ; 4053.0bp to feature; MODIFIER silent_mutation Average:69.872; most accessible tissue: Callus, score: 95.357 N N N N
vg0102765446 C -> T LOC_Os01g05780-LOC_Os01g05790 intergenic_region ; MODIFIER silent_mutation Average:69.872; most accessible tissue: Callus, score: 95.357 N N N N
vg0102765446 C -> DEL N N silent_mutation Average:69.872; most accessible tissue: Callus, score: 95.357 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102765446 C T 0.03 0.04 0.04 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102765446 NA 1.08E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 7.53E-09 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 1.66E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 2.70E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 9.91E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 1.22E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 3.01E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 4.92E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 3.16E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 8.97E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 2.66E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 4.15E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 3.34E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 7.27E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 4.69E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 1.08E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 2.18E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 3.16E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 9.94E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 2.55E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 1.50E-11 mr1871_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102765446 NA 4.27E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251