\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102697328:

Variant ID: vg0102697328 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2697328
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACTCAAGACTTATGTTTTTTATTTTTTAAAAAAAAATTAAATAAAACGGACGGTTAAATTTGGGCGCGAAAAAACCATGCCTGTACTCAAAATGCGAC[G/A]
GAGAAAGTACTCATAGTAAATAGGAGGAACACAATTTACACAAATGAAGTTGCTGCATTACAAGCTTGATTAAGTCGGTGCTTGGAAGAATAATATATAT

Reverse complement sequence

ATATATATTATTCTTCCAAGCACCGACTTAATCAAGCTTGTAATGCAGCAACTTCATTTGTGTAAATTGTGTTCCTCCTATTTACTATGAGTACTTTCTC[C/T]
GTCGCATTTTGAGTACAGGCATGGTTTTTTCGCGCCCAAATTTAACCGTCCGTTTTATTTAATTTTTTTTTAAAAAATAAAAAACATAAGTCTTGAGTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 11.40% 0.19% 5.61% NA
All Indica  2759 73.70% 16.70% 0.18% 9.39% NA
All Japonica  1512 96.40% 3.20% 0.26% 0.20% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 90.60% 3.70% 0.50% 5.21% NA
Indica II  465 67.50% 29.50% 0.22% 2.80% NA
Indica III  913 69.70% 15.90% 0.11% 14.35% NA
Indica Intermediate  786 69.20% 20.10% 0.00% 10.69% NA
Temperate Japonica  767 99.10% 0.50% 0.00% 0.39% NA
Tropical Japonica  504 92.30% 7.50% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 2.50% 1.24% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102697328 G -> A LOC_Os01g05650.1 upstream_gene_variant ; 2243.0bp to feature; MODIFIER silent_mutation Average:71.736; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0102697328 G -> A LOC_Os01g05660.1 downstream_gene_variant ; 1600.0bp to feature; MODIFIER silent_mutation Average:71.736; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0102697328 G -> A LOC_Os01g05660.2 downstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:71.736; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0102697328 G -> A LOC_Os01g05660.3 downstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:71.736; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0102697328 G -> A LOC_Os01g05650-LOC_Os01g05660 intergenic_region ; MODIFIER silent_mutation Average:71.736; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0102697328 G -> DEL N N silent_mutation Average:71.736; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102697328 G A 0.0 0.01 0.01 -0.03 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102697328 NA 6.46E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 5.00E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 5.22E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 3.94E-13 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 7.92E-06 1.79E-16 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 2.18E-11 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 1.57E-11 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 4.04E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 4.23E-07 1.36E-16 mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 2.98E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 5.53E-17 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 1.81E-09 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102697328 NA 5.73E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251