\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102692289:

Variant ID: vg0102692289 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2692289
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGAACATTCGGATAAATATATGAAGTATTAAATATAAAAAAAATACTAATTATATAGATTATGTGTAAATTATGAGACGAATCTTTTAAGTCTAATTA[C/T]
AGTAAATATTTGCTTGTTAATGATAAATTAATTATGTTTAATAAATTTATCTCATAGCTTACTATCGGATTTTGTAATAAGTATTTTTATCAGTGCCGGA

Reverse complement sequence

TCCGGCACTGATAAAAATACTTATTACAAAATCCGATAGTAAGCTATGAGATAAATTTATTAAACATAATTAATTTATCATTAACAAGCAAATATTTACT[G/A]
TAATTAGACTTAAAAGATTCGTCTCATAATTTACACATAATCTATATAATTAGTATTTTTTTTATATTTAATACTTCATATATTTATCCGAATGTTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.60% 0.13% 0.00% NA
All Indica  2759 99.30% 0.70% 0.04% 0.00% NA
All Japonica  1512 68.90% 30.80% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 49.50% 49.90% 0.52% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 68.50% 31.10% 0.41% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102692289 C -> T LOC_Os01g05640.1 upstream_gene_variant ; 103.0bp to feature; MODIFIER silent_mutation Average:87.131; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0102692289 C -> T LOC_Os01g05630.1 downstream_gene_variant ; 4589.0bp to feature; MODIFIER silent_mutation Average:87.131; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0102692289 C -> T LOC_Os01g05650.1 downstream_gene_variant ; 845.0bp to feature; MODIFIER silent_mutation Average:87.131; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0102692289 C -> T LOC_Os01g05640-LOC_Os01g05650 intergenic_region ; MODIFIER silent_mutation Average:87.131; most accessible tissue: Minghui63 root, score: 95.404 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102692289 C T 0.03 -0.01 -0.03 0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102692289 NA 4.05E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 5.46E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 1.16E-07 NA mr1916 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 5.69E-07 1.56E-10 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 1.39E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 3.87E-10 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 1.01E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 1.86E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 3.17E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 5.85E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 8.44E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102692289 NA 2.21E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251