\
| Variant ID: vg0102555772 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2555772 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGTGCGGCTAAAAAAACGTAAATACCTGGGAAATCCAGTACATAATCTCTCGTATATCTTAAACTAGGGGTAAAAATGTCATTTCAAATTTCTCTTGCT[G/A]
ACATGACAATCTAATTAGGAAAAATATCTCACTTATGTGGTATTTATGTAAAAAAAGAAGGAAGAGTGGCATCTCAGTAGTGCCACTCCGTAAGAGTTGC
GCAACTCTTACGGAGTGGCACTACTGAGATGCCACTCTTCCTTCTTTTTTTACATAAATACCACATAAGTGAGATATTTTTCCTAATTAGATTGTCATGT[C/T]
AGCAAGAGAAATTTGAAATGACATTTTTACCCCTAGTTTAAGATATACGAGAGATTATGTACTGGATTTCCCAGGTATTTACGTTTTTTTAGCCGCACGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 11.00% | 0.57% | 35.93% | NA |
| All Indica | 2759 | 54.00% | 0.80% | 0.65% | 44.58% | NA |
| All Japonica | 1512 | 52.80% | 31.80% | 0.20% | 15.21% | NA |
| Aus | 269 | 24.20% | 0.00% | 1.49% | 74.35% | NA |
| Indica I | 595 | 32.10% | 1.30% | 0.84% | 65.71% | NA |
| Indica II | 465 | 64.30% | 0.90% | 0.65% | 34.19% | NA |
| Indica III | 913 | 56.80% | 0.00% | 0.55% | 42.61% | NA |
| Indica Intermediate | 786 | 61.20% | 1.10% | 0.64% | 37.02% | NA |
| Temperate Japonica | 767 | 42.50% | 53.60% | 0.13% | 3.78% | NA |
| Tropical Japonica | 504 | 70.00% | 1.00% | 0.20% | 28.77% | NA |
| Japonica Intermediate | 241 | 49.40% | 27.00% | 0.41% | 23.24% | NA |
| VI/Aromatic | 96 | 71.90% | 14.60% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 66.70% | 3.30% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102555772 | G -> A | LOC_Os01g05400.1 | downstream_gene_variant ; 3651.0bp to feature; MODIFIER | silent_mutation | Average:43.322; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0102555772 | G -> A | LOC_Os01g05410.1 | downstream_gene_variant ; 1751.0bp to feature; MODIFIER | silent_mutation | Average:43.322; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0102555772 | G -> A | LOC_Os01g05410-LOC_Os01g05420 | intergenic_region ; MODIFIER | silent_mutation | Average:43.322; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0102555772 | G -> DEL | N | N | silent_mutation | Average:43.322; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102555772 | NA | 8.76E-08 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 2.26E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 8.93E-07 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 3.90E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 6.44E-08 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 5.01E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 6.83E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 6.95E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | 9.89E-09 | 3.88E-12 | mr1567_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 2.19E-08 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 3.78E-07 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 7.70E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 7.72E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | 6.78E-07 | NA | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | 2.62E-07 | 4.43E-15 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 1.12E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | 1.62E-06 | 3.37E-20 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102555772 | NA | 5.36E-07 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |