\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102476510:

Variant ID: vg0102476510 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2476510
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTGCATTGTGATGCTGTGACTGAATCTGAAAATTTGGCAGCGAGAATGAATATCAAGTAATGTTGTGCATATCCCCGCAGCCTGGACATGATCCAA[C/T]
TATCACAGTGAGCTCGGCCCAACTAAACTTGGGCTGACTTGGGCAGCTATCCATATTTTCATGGGTTGACTTGGGCTTACAAATTTCTCCCAAAACGATG

Reverse complement sequence

CATCGTTTTGGGAGAAATTTGTAAGCCCAAGTCAACCCATGAAAATATGGATAGCTGCCCAAGTCAGCCCAAGTTTAGTTGGGCCGAGCTCACTGTGATA[G/A]
TTGGATCATGTCCAGGCTGCGGGGATATGCACAACATTACTTGATATTCATTCTCGCTGCCAAATTTTCAGATTCAGTCACAGCATCACAATGCACTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 10.30% 1.10% 21.46% NA
All Indica  2759 79.50% 0.70% 1.09% 18.74% NA
All Japonica  1512 46.70% 27.80% 0.60% 24.87% NA
Aus  269 67.70% 9.30% 1.86% 21.19% NA
Indica I  595 94.80% 0.00% 0.34% 4.87% NA
Indica II  465 80.40% 1.10% 2.15% 16.34% NA
Indica III  913 70.80% 0.10% 0.99% 28.15% NA
Indica Intermediate  786 77.60% 1.50% 1.15% 19.72% NA
Temperate Japonica  767 56.70% 4.70% 0.78% 37.81% NA
Tropical Japonica  504 30.40% 61.50% 0.40% 7.74% NA
Japonica Intermediate  241 49.00% 31.10% 0.41% 19.50% NA
VI/Aromatic  96 42.70% 5.20% 4.17% 47.92% NA
Intermediate  90 57.80% 17.80% 4.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102476510 C -> T LOC_Os01g05250.1 downstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:92.4; most accessible tissue: Zhenshan97 root, score: 98.672 N N N N
vg0102476510 C -> T LOC_Os01g05260.1 downstream_gene_variant ; 1566.0bp to feature; MODIFIER silent_mutation Average:92.4; most accessible tissue: Zhenshan97 root, score: 98.672 N N N N
vg0102476510 C -> T LOC_Os01g05250-LOC_Os01g05260 intergenic_region ; MODIFIER silent_mutation Average:92.4; most accessible tissue: Zhenshan97 root, score: 98.672 N N N N
vg0102476510 C -> DEL N N silent_mutation Average:92.4; most accessible tissue: Zhenshan97 root, score: 98.672 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102476510 C T -0.07 -0.08 -0.06 -0.07 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102476510 NA 1.73E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102476510 NA 9.15E-06 mr1924 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102476510 NA 7.37E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102476510 NA 7.17E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102476510 NA 1.64E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251