\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102416437:

Variant ID: vg0102416437 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2416437
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTCGGGATCGCTTGTGGTAGGTGTTGGGCACTTGGGGTTTGAAAGACAGCATCGTTGATGTGCTTTGAGTTCCTGCCTAATTGACTTACGCTGACTCTG[T/C]
CAATATCAACATCTTCAGTTACTATTCCCATAATCCCTAAAATCCCAGCAGTTGCGTGGTAGGTTATGTAAAGCGCATTCCTGTGATGAAAAATAGACCC

Reverse complement sequence

GGGTCTATTTTTCATCACAGGAATGCGCTTTACATAACCTACCACGCAACTGCTGGGATTTTAGGGATTATGGGAATAGTAACTGAAGATGTTGATATTG[A/G]
CAGAGTCAGCGTAAGTCAATTAGGCAGGAACTCAAAGCACATCAACGATGCTGTCTTTCAAACCCCAAGTGCCCAACACCTACCACAAGCGATCCCGACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 21.60% 1.08% 16.04% NA
All Indica  2759 63.10% 17.90% 0.76% 18.19% NA
All Japonica  1512 57.50% 25.60% 1.39% 15.48% NA
Aus  269 71.40% 21.20% 2.23% 5.20% NA
Indica I  595 39.30% 4.00% 1.51% 55.13% NA
Indica II  465 93.80% 3.20% 0.86% 2.15% NA
Indica III  913 58.70% 33.40% 0.22% 7.67% NA
Indica Intermediate  786 68.20% 19.10% 0.76% 11.96% NA
Temperate Japonica  767 90.60% 4.20% 1.96% 3.26% NA
Tropical Japonica  504 14.50% 60.10% 0.60% 24.80% NA
Japonica Intermediate  241 42.30% 21.60% 1.24% 34.85% NA
VI/Aromatic  96 40.60% 58.30% 1.04% 0.00% NA
Intermediate  90 57.80% 31.10% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102416437 T -> DEL N N silent_mutation Average:49.725; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0102416437 T -> C LOC_Os01g05160.1 upstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:49.725; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0102416437 T -> C LOC_Os01g05150.1 downstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:49.725; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0102416437 T -> C LOC_Os01g05150-LOC_Os01g05160 intergenic_region ; MODIFIER silent_mutation Average:49.725; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102416437 T C -0.04 -0.05 -0.04 -0.01 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102416437 4.94E-06 5.11E-08 Yield Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102416437 NA 1.95E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102416437 2.71E-06 1.15E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102416437 NA 1.21E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102416437 NA 1.12E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102416437 NA 1.94E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102416437 4.06E-08 3.25E-18 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251