\
| Variant ID: vg0102402484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2402484 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 286. )
GGAAAGATCGTTTTTTTACTGAAGATGTTAGGAACTTACCGAGCCGATCAAGAGCAGATACAGGCATGAAGACTGCAAACAAATTAAACATAAGCAAAAC[T/A]
TCGTAATATTCAGTTAGAAAAAAAAATAGATTGACTACTGACTATTAATAACAGGTTAATTAGCAACTTACCCCTGTTGCCATCGTCGGCGTTCTCCTTC
GAAGGAGAACGCCGACGATGGCAACAGGGGTAAGTTGCTAATTAACCTGTTATTAATAGTCAGTAGTCAATCTATTTTTTTTTCTAACTGAATATTACGA[A/T]
GTTTTGCTTATGTTTAATTTGTTTGCAGTCTTCATGCCTGTATCTGCTCTTGATCGGCTCGGTAAGTTCCTAACATCTTCAGTAAAAAAACGATCTTTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.60% | 23.20% | 0.06% | 0.19% | NA |
| All Indica | 2759 | 70.10% | 29.40% | 0.11% | 0.33% | NA |
| All Japonica | 1512 | 83.90% | 16.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 35.60% | 63.90% | 0.00% | 0.50% | NA |
| Indica II | 465 | 94.80% | 4.50% | 0.22% | 0.43% | NA |
| Indica III | 913 | 74.70% | 25.10% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 76.30% | 23.20% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102402484 | T -> A | LOC_Os01g05130.1 | upstream_gene_variant ; 786.0bp to feature; MODIFIER | silent_mutation | Average:73.405; most accessible tissue: Callus, score: 89.812 | N | N | N | N |
| vg0102402484 | T -> A | LOC_Os01g05140.1 | upstream_gene_variant ; 3954.0bp to feature; MODIFIER | silent_mutation | Average:73.405; most accessible tissue: Callus, score: 89.812 | N | N | N | N |
| vg0102402484 | T -> A | LOC_Os01g05105.1 | downstream_gene_variant ; 4192.0bp to feature; MODIFIER | silent_mutation | Average:73.405; most accessible tissue: Callus, score: 89.812 | N | N | N | N |
| vg0102402484 | T -> A | LOC_Os01g05120.1 | intron_variant ; MODIFIER | silent_mutation | Average:73.405; most accessible tissue: Callus, score: 89.812 | N | N | N | N |
| vg0102402484 | T -> DEL | N | N | silent_mutation | Average:73.405; most accessible tissue: Callus, score: 89.812 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102402484 | NA | 1.56E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | NA | 1.23E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | NA | 6.36E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | NA | 8.56E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | 7.96E-06 | 3.50E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | NA | 3.85E-06 | mr1534 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | NA | 5.42E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102402484 | 2.96E-07 | NA | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |