Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102402484:

Variant ID: vg0102402484 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2402484
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAAGATCGTTTTTTTACTGAAGATGTTAGGAACTTACCGAGCCGATCAAGAGCAGATACAGGCATGAAGACTGCAAACAAATTAAACATAAGCAAAAC[T/A]
TCGTAATATTCAGTTAGAAAAAAAAATAGATTGACTACTGACTATTAATAACAGGTTAATTAGCAACTTACCCCTGTTGCCATCGTCGGCGTTCTCCTTC

Reverse complement sequence

GAAGGAGAACGCCGACGATGGCAACAGGGGTAAGTTGCTAATTAACCTGTTATTAATAGTCAGTAGTCAATCTATTTTTTTTTCTAACTGAATATTACGA[A/T]
GTTTTGCTTATGTTTAATTTGTTTGCAGTCTTCATGCCTGTATCTGCTCTTGATCGGCTCGGTAAGTTCCTAACATCTTCAGTAAAAAAACGATCTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	23.20%	0.06%	0.19%	NA
All Indica	2759	70.10%	29.40%	0.11%	0.33%	NA
All Japonica	1512	83.90%	16.10%	0.00%	0.00%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	35.60%	63.90%	0.00%	0.50%	NA
Indica II	465	94.80%	4.50%	0.22%	0.43%	NA
Indica III	913	74.70%	25.10%	0.11%	0.11%	NA
Indica Intermediate	786	76.30%	23.20%	0.13%	0.38%	NA
Temperate Japonica	767	96.20%	3.80%	0.00%	0.00%	NA
Tropical Japonica	504	74.00%	26.00%	0.00%	0.00%	NA
Japonica Intermediate	241	65.10%	34.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102402484	T -> A	LOC_Os01g05130.1	upstream_gene_variant ; 786.0bp to feature; MODIFIER	silent_mutation	Average:73.405; most accessible tissue: Callus, score: 89.812	N	N	N	N
vg0102402484	T -> A	LOC_Os01g05140.1	upstream_gene_variant ; 3954.0bp to feature; MODIFIER	silent_mutation	Average:73.405; most accessible tissue: Callus, score: 89.812	N	N	N	N
vg0102402484	T -> A	LOC_Os01g05105.1	downstream_gene_variant ; 4192.0bp to feature; MODIFIER	silent_mutation	Average:73.405; most accessible tissue: Callus, score: 89.812	N	N	N	N
vg0102402484	T -> A	LOC_Os01g05120.1	intron_variant ; MODIFIER	silent_mutation	Average:73.405; most accessible tissue: Callus, score: 89.812	N	N	N	N
vg0102402484	T -> DEL	N	N	silent_mutation	Average:73.405; most accessible tissue: Callus, score: 89.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102402484	NA	1.56E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	NA	1.23E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	NA	6.36E-06	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	NA	8.56E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	7.96E-06	3.50E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	NA	3.85E-06	mr1534	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	NA	5.42E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484	2.96E-07	NA	mr1973_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251