\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102402484:

Variant ID: vg0102402484 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2402484
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAGATCGTTTTTTTACTGAAGATGTTAGGAACTTACCGAGCCGATCAAGAGCAGATACAGGCATGAAGACTGCAAACAAATTAAACATAAGCAAAAC[T/A]
TCGTAATATTCAGTTAGAAAAAAAAATAGATTGACTACTGACTATTAATAACAGGTTAATTAGCAACTTACCCCTGTTGCCATCGTCGGCGTTCTCCTTC

Reverse complement sequence

GAAGGAGAACGCCGACGATGGCAACAGGGGTAAGTTGCTAATTAACCTGTTATTAATAGTCAGTAGTCAATCTATTTTTTTTTCTAACTGAATATTACGA[A/T]
GTTTTGCTTATGTTTAATTTGTTTGCAGTCTTCATGCCTGTATCTGCTCTTGATCGGCTCGGTAAGTTCCTAACATCTTCAGTAAAAAAACGATCTTTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.20% 0.06% 0.19% NA
All Indica  2759 70.10% 29.40% 0.11% 0.33% NA
All Japonica  1512 83.90% 16.10% 0.00% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 35.60% 63.90% 0.00% 0.50% NA
Indica II  465 94.80% 4.50% 0.22% 0.43% NA
Indica III  913 74.70% 25.10% 0.11% 0.11% NA
Indica Intermediate  786 76.30% 23.20% 0.13% 0.38% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 74.00% 26.00% 0.00% 0.00% NA
Japonica Intermediate  241 65.10% 34.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102402484 T -> A LOC_Os01g05130.1 upstream_gene_variant ; 786.0bp to feature; MODIFIER silent_mutation Average:73.405; most accessible tissue: Callus, score: 89.812 N N N N
vg0102402484 T -> A LOC_Os01g05140.1 upstream_gene_variant ; 3954.0bp to feature; MODIFIER silent_mutation Average:73.405; most accessible tissue: Callus, score: 89.812 N N N N
vg0102402484 T -> A LOC_Os01g05105.1 downstream_gene_variant ; 4192.0bp to feature; MODIFIER silent_mutation Average:73.405; most accessible tissue: Callus, score: 89.812 N N N N
vg0102402484 T -> A LOC_Os01g05120.1 intron_variant ; MODIFIER silent_mutation Average:73.405; most accessible tissue: Callus, score: 89.812 N N N N
vg0102402484 T -> DEL N N silent_mutation Average:73.405; most accessible tissue: Callus, score: 89.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102402484 NA 1.56E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 NA 1.23E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 NA 6.36E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 NA 8.56E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 7.96E-06 3.50E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 NA 3.85E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 NA 5.42E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102402484 2.96E-07 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251